KEGG   Dictyoglomus thermophilum: DICTH_0624Help
Entry
DICTH_0624        tRNA      T00774                                 

Definition
(GenBank) tRNA-Gln
  KO
K14223  
tRNA Gln
Organism
dth  Dictyoglomus thermophilum
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:dth00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    DICTH_0624
Non-coding RNAs [BR:dth03100]
 Transfer RNA
  tRNA
   DICTH_0624
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
631071..631148
Genome map
NT seq 78 nt NT seq  +upstreamnt  +downstreamnt
ttggggagtagccaagctggtaaggcagcggactttggatccgccattcgctggttcgaa
tccagcctccccagccaa

DBGET integrated database retrieval system