KEGG   Drosophila virilis: Dvir_GJ23281Help
Entry
Dvir_GJ23281      CDS       T01066                                 

Definition
GJ23281 gene product from transcript GJ23281-RA
Orthology
K14459  
hexosaminidase [EC:3.2.1.52]
Organism
dvi  Drosophila virilis
Pathway
Other glycan degradation
Brite
KEGG Orthology (KO) [BR:dvi00001]
 Metabolism
  Glycan biosynthesis and metabolism
   00511 Other glycan degradation
    Dvir_GJ23281
Enzymes [BR:dvi01000]
 3. Hydrolases
  3.2  Glycosylases
   3.2.1  Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds
    3.2.1.52  beta-N-acetylhexosaminidase
     Dvir_GJ23281
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
FlyBase: 
UniProt: 
AA seq 710 aa AA seqDB search
MHSNLLIFIWRRKLSFLLLASGLVLLGLWTWAILIDSAKTLPAFTQQTSQSGEANYQHVH
IIQKLIAQANRVLRAERQRDNAERTSPTQRLLGNVRFVRPTQAKKAPLPLAESYLFEQER
LKILEQQQRQRNAGMDELNANAEDDRMLSSAERQTQYEHELQRMGVPAVAGIGPDGPRAP
AERLVHLDLKGAPPKLSFLKQLLPVLRALGATGLLIEYEDMFPYSGALQPLAAHNAYKEA
ELKDFLETAWVEYGLSVMPLVQTFGHLEYALKLSGFEQLRELPESPQSICPSQPQSLALL
EQMLTQVIELHMRPSGNATPSTPELPIKFTHLHIGCDEVQRMGECSLCRQRLRSELFLSH
VISLAHFVRRRWPQLSVVIWDDQLRDMTLSELQNSQIGSYVEPMVWVYASDIYHFIQPQL
WDTYSKVFPSAWAASAYKGAFGESLLVPPLQQHLENNIRWLAVIAKEGGRFAKGLRGLAL
TGWQRYDHFAVLCELLPVGMPSLMTSLSTVSKGYFSTNPRDNELLRVLRCVFQPDSRRSG
HPWLELHTNAHYSQLFAVCSYPGHLVFKYALRLYDKLAEVRNYLQQTREHSAWLSDYNVR
HNFSSPLRVQELTVRTPQLIEELRAMARESQQLLWEVYDEHTVAEFVEQHIYPSINALHQ
QLANGQTLLQRRTWPQRPLPLTMELQQDMGLVTTLDHHQQQQQQQQQQQH
NT seq 2133 nt NT seq  +upstreamnt  +downstreamnt
atgcactcaaatttgctgatatttatttggcgccgcaaactttcatttctgctgctggcg
tcgggtcttgtcttgcttggactctggacatgggccatacttattgatagtgcaaaaaca
ctgccagcatttacacagcagacatcgcaatccggcgaggccaattatcagcacgttcac
atcatccagaagttgattgcccaagcgaatcgtgtgctgcgcgccgagcgacaaagggac
aacgcggagcgaacatcgccgacacagcgtttgctgggcaacgtgcgctttgtgcgtccg
acacaggccaagaaggcgccgctgcctctggccgagagctatctgttcgagcaggaacgc
ctcaagatcctagagcaacagcagcgccagcgcaacgcgggcatggacgagctcaatgcc
aacgccgaggatgatcgcatgctcagctctgcggagcgtcagacccaatacgagcacgaa
ttgcaacgcatgggcgtgccagctgtcgcaggcattggcccggatggaccacgtgctcca
gcagagcgactggtccacctggatcttaaaggcgcgccacccaagctgagctttctcaag
caactcttgcctgtgctgcgcgccttgggtgccaccgggctgcttatcgagtatgaggat
atgtttccctatagcggtgcgctgcagccacttgctgctcacaatgcctacaaggaagcc
gaactgaaggattttctggaaactgcttgggtcgagtatggtctgagcgttatgccgctg
gtccaaacttttgggcatctggagtacgccctgaagttgtccggatttgagcagctacgt
gagctgcccgagagcccgcagtcgatttgccctagtcaaccgcagagtctagccttgctg
gagcaaatgctcacccaggtgattgagctgcatatgcggccctcgggcaatgccacgccc
tcgacgccggagctgcccatcaagtttacccatttgcacattggctgcgatgaggtgcag
cgcatgggcgagtgttcgctctgtcgtcagcgactgcgaagcgaactgttcctttcgcat
gtgattagcttggcgcattttgtgcgtcgtcgctggccgcagctgagcgtggtcatctgg
gatgatcagctgcgtgacatgacgctgagcgagctgcagaactcgcagatcggcagctat
gtagagcccatggtgtgggtgtatgccagcgatatatatcattttatacagccacagctg
tgggacacctattcgaaggtatttcccagcgcctgggctgcgtccgcttacaagggcgcg
tttggcgagagtctgctggtgcccccgctgcagcagcatttggagaacaatatacgctgg
ctggcggtcatagctaaggagggtgggcgctttgccaagggcttgaggggcctggcgctg
actggctggcagcgctatgatcattttgccgtgctctgtgagctgttgccggtgggcatg
cccagcctaatgacatctttgtccacagtgtccaagggttactttagcaccaatccacgt
gacaatgagctgttgcgcgtgctgcgttgcgttttccagccggatagccggcgctcggga
catccttggctggaattacataccaatgcacattacagtcaactattcgctgtgtgcagc
tatccgggccacctggtcttcaagtacgcgctgcgtttatacgacaaactggccgaggtg
cgcaactatctgcaacagacgcgggagcacagtgcctggctctccgactacaatgtcaga
cacaactttagttcgcccctgcgagtgcaggagctgacggtgcgcacaccccaactaatt
gaggagctgcgcgctatggcacgcgagtcccaacagctcttgtgggaagtgtacgatgag
catacggtagcggaatttgtggagcagcacatttatcccagcatcaatgcgctgcatcag
cagctggctaatggacaaacgctgttgcagagacgcacctggccgcaacggccgctgccg
cttaccatggagctgcagcaagatatggggcttgttaccacgttggatcatcatcagcag
cagcagcagcagcagcagcagcagcagcattaa

  All links  
No link information was found.   
DBGET integrated database retrieval system