KEGG   Drosophila willistoni: Dwil_GK24294Help
Entry
Dwil_GK24294      CDS       T01067                                 

Definition
GK24294 gene product from transcript GK24294-RA
Orthology
K00699  
glucuronosyltransferase [EC:2.4.1.17]
Organism
dwi  Drosophila willistoni
Pathway
Pentose and glucuronate interconversions
Ascorbate and aldarate metabolism
Starch and sucrose metabolism
Retinol metabolism
Porphyrin and chlorophyll metabolism
Metabolism of xenobiotics by cytochrome P450
Drug metabolism - cytochrome P450
Drug metabolism - other enzymes
Metabolic pathways
Brite
KEGG Orthology (KO) [BR:dwi00001]
 Metabolism
  Carbohydrate metabolism
   00040 Pentose and glucuronate interconversions
    Dwil_GK24294
   00053 Ascorbate and aldarate metabolism
    Dwil_GK24294
   00500 Starch and sucrose metabolism
    Dwil_GK24294
  Metabolism of cofactors and vitamins
   00830 Retinol metabolism
    Dwil_GK24294
   00860 Porphyrin and chlorophyll metabolism
    Dwil_GK24294
  Xenobiotics biodegradation and metabolism
   00980 Metabolism of xenobiotics by cytochrome P450
    Dwil_GK24294
   00982 Drug metabolism - cytochrome P450
    Dwil_GK24294
   00983 Drug metabolism - other enzymes
    Dwil_GK24294
Enzymes [BR:dwi01000]
 2. Transferases
  2.4  Glycosyltransferases
   2.4.1  Hexosyltransferases
    2.4.1.17  glucuronosyltransferase
     Dwil_GK24294
Glycosyltransferases [BR:dwi01003]
 Others
  Hydrophobic molecule
   Dwil_GK24294
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
FlyBase: 
UniProt: 
AA seq 313 aa AA seqDB search
MNWSLSFSLHLLVYWLSSSAVQSHHILGLFVNVHRSQLLVHLAVARVLLQRGHQLTLVTT
LPLDDLDEEFKENVTHILVDWQSSPEEKLSSNDFLTRLEHMFRRLEHSGNLLKHSTWKNF
MAHTPKPHFDLLLLGYHFNDHLLGVAAHFKCPVVIITTQQPICQVNSLMGNPEERWYVPQ
PYDSRQRSGLEAWIFGWWEKGIELLSRRILARIYSENFPSPQYPDFDTMRRSVVMSFNNH
HMISEGPIQPMLPTMLDIGGILIEQTPKVNHGHANGKQNCMCIAHESNDSNGNDISNIKP
GKHSISGNKQTQS
NT seq 942 nt NT seq  +upstreamnt  +downstreamnt
atgaattggtcgctcagcttttcacttcatttgctcgtctactggctatcgagtagtgct
gtccaatcccatcatattctgggactctttgtcaatgtgcatcgttcccagctattggtt
catttggcagtggctcgggtacttcttcaacggggtcatcaattgactctggttaccaca
ttgcccttggatgatttggatgaagaatttaaggagaatgtgactcacattttggtggac
tggcagtcttctccagaggaaaaactatcctctaacgatttcttgactcgtttggagcat
atgtttagacgtttggagcactcgggaaatttgctaaagcattcgacatggaaaaatttc
atggcacatacacccaaaccacatttcgatcttttgttactgggctatcatttcaatgat
catttactgggcgtggccgcccatttcaagtgtccagtggttattatcacgacacagcaa
cccatttgccaagtcaatagccttatgggcaatcccgaagaacgttggtatgttcctcaa
ccctacgatagtcgccagagaagtggacttgaggcctggatatttggatggtgggaaaag
ggcattgagctattgtctcgacgcattctggcaaggatatacagtgaaaactttccctca
ccgcaatatcccgattttgatacaatgcgacgttcggtagttatgtctttcaataatcat
cacatgatcagcgaaggacccatacaacctatgttgcctaccatgctggatattggtggc
attttaatagaacaaacgccaaaagttaaccatggacatgccaatggaaaacagaattgc
atgtgcattgcccatgagtcaaatgacagcaacggcaacgacatcagcaacatcaagcca
ggcaaacattcgatatcgggcaataaacaaacacagagctaa

DBGET integrated database retrieval system