KEGG   Escherichia coli B REL606: ECB_03333Help
Entry
ECB_03333         gene      T00944                                 

Gene name
yrhC
Definition
(GenBank) pseudogene
Organism
ebr  Escherichia coli B REL606
SSDB OrthologParalogGene clusterGFIT
Position
3554575..3554820
Genome map
NT seq 246 nt NT seq  +upstreamnt  +downstreamnt
atgtcaaatacataccagaaaagaaaggcaagtaaagagtatggtttatataataaatgt
aagaaactaaatgatgatgaattatttcgcttacttgatgatcgcaattccttgaaaagg
atttcatctgccagagtattacagttaagaggggggcaagacgctgttagattggcaatt
gaattctgcactgacaaaaattatatccgtagagatatcggagcatttatactcgggcaa
atataa

DBGET integrated database retrieval system