KEGG   Escherichia coli B REL606: ECB_03382Help
Entry
ECB_03382         gene      T00944                                 

Gene name
yhjQ
Definition
(GenBank) pseudogene
Organism
ebr  Escherichia coli B REL606
SSDB OrthologParalogGene clusterGFIT
Position
complement(3624725..3625462)
Genome map
NT seq 738 nt NT seq  +upstreamnt  +downstreamnt
ttgcagggggggcggggaggcgtggggacaacaaccatcaccgccgcattagcctggtca
ttacaaatgttgggagaaaatgtcctggtggtcgatgcctgcccggacaacttgttgcgc
ctgtcatttaacgttgattttacccaccgtcagggctgggccagagctatgctggatggc
caggactggcgtgacgccgggttgcgctacacctcgcagctcgatttgctgccttttggt
cagttatccattgaagaacaagaaaatccacagcactggcaaacccggctgagcgatatt
tgctccggcttacagcaactaaaagccagcgggcgttaccagtggattttaatcgactta
ccgcgtgatgcctcgcagataacccaccagctgctgagtttgtgcgatcactcgctggca
atcgtcaatgtggatgccaactgccatatccgactgcatcagcaagcgctgccggatggc
gcacatattttgattaataacttccgtattggcagtcaggttcaggacgatatttaccag
ctttggttgcaaagccagcgccgattactgccgatgctcattcatcgtgatgaagcgatg
gctgaatgcctggcggctaagcaaccagtaggtgaatatcgcagtgatgcgctggcggct
gaagagatactgacgctggcgaactggtgcctgttgaactattccgggctgaaaacgcca
gtcgggagtaaatcatga

DBGET integrated database retrieval system