KEGG   Escherichia coli K-12 DH10B: ECDH10B_3855Help
Entry
ECDH10B_3855      CDS       T00666                                 

Gene name
ivbL
Definition
(GenBank) ilvB operon leader peptide
Organism
ecd  Escherichia coli K-12 DH10B
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: IlvB_leader
Motif
Other DBs
NCBI-ProteinID: ACB04721
Position
complement(3948497..3948595)
Genome map
AA seq 32 aa AA seqDB search
MTTSMLNAKLLPTAPSAAVVVVRVVVVVGNAP
NT seq 99 nt NT seq  +upstreamnt  +downstreamnt
atgactacttccatgctcaacgcaaaactactaccaactgcgccatccgccgcagtggtc
gtcgtgcgtgtggtggtggtcgtcggcaatgcgccgtag

DBGET integrated database retrieval system