KEGG   Escherichia coli K-12 DH10B: ECDH10B_3869Help
Entry
ECDH10B_3869      gene      T00666                                 

Gene name
glvC
Definition
(GenBank) pseudogene
Organism
ecd  Escherichia coli K-12 DH10B
SSDB OrthologParalogGene clusterGFIT
Position
complement(3957594..3959210)
Genome map
NT seq 1617 nt NT seq  +upstreamnt  +downstreamnt
atgctcagtcaaattcaacgctttggcggcgcgatgttcacgccagtgctgctgtttccc
ttcgccgggattgtggtgggtcttgccatcttgctgcaaaacccgatgtttgtcggggaa
tcactgaccgatccgaacagtttattcgcgcaaatcgtacacattattgaagagggcggt
tggacggtattccgtaatatgccgctgatttttgctgtcggtttacccattggccttgct
aagcaagcgcaggggcgtgcttgtctggcggtgatggtgagtttcctgacctggaactat
ttcatcaacgcgatgggaatgacctggggaagctacttcggcgtcgatttcactcaggac
gcggtggcaggtagcggtctgacaatgatggccgggattaaaaccctcgataccagcatt
atcggcgcaattatcatttccggcattgtgacggcgctgcataaccgtctgttcgataaa
aaactgccggtttttctcggcattttccaggggacgtcttatgtggtgattatcgccttc
ctggtgatgatcccctgtgcctggctgacgttgctcggctggccaaaagtacaaatgggg
attgaatctctgcaagcgttcctgcgttcggcgggtgcacttggggtctgggtttacacc
ttcctcgaacgtattctgatcccaaccggtttacaccacttcatctacggacagtttatc
tttggtccggcagctgttgaaggcggcattcagatgtactgggcgcagcatctgcaagag
ttcagtttgagcgccgagccgctgaaatcgttgttcccggaaggcggttttgccctgcac
ggtaactcaaaaatctttggtgccgtgggcatttctttagcgatgtacttcactgccgca
ccggaaaatcgggtaaaagtggcgggcttgctgattcccgcaaccttaaccgccatgctg
gtgggaattaccgaaccgctggaatttaccttcctgttcatttcaccgttgctgtttgcg
gtacacgccgtgctggcggcctcaatgtcgaccgtaatgtatctctttggtgtggtgggc
aacatgggcggaggtctgattgactaggttttaccgcaaaactggatcccgatgttcagc
aaccacgcggatatgatgctgacccaaatcgccattgggttgtgctttaccctgctgtac
ttcgtggttttccgcacactgattctgcagttcaacatgtgcacgccgggacgtgaagat
gcggaagtgaaactctactcaaaagccgaatacaaagcctcgcgaggccaaaccaccgcg
gcagagccaaaaaaagagctggatcaggctgccggtatcctgcaagccctgggcggggtc
ggcaatatctccagcattaacaattgcgcgacgcgtttacgtattgcactgcatgacatg
tcacaaacgctggatgacgaagtctttaaaaagctgggagcgcacggcgtcttccgtagt
ggcgatgccattcaggtgatcattggtctgcatgtatctcagctgcgtgaacagctcgat
agcttaattaattctcatcaatcagcagaaaatgttgccattacggaggcagtataa

DBGET integrated database retrieval system