KEGG   Escherichia coli O157 H7 EC4115 (EHEC): ECH74115_3876Help
Entry
ECH74115_3876     CDS       T00778                                 

Definition
lysozyme (EC:3.2.1.17)
Orthology
K01185  
lysozyme [EC:3.2.1.17]
Organism
ecf  Escherichia coli O157:H7 EC4115 (EHEC)
Class
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
complement(3587365..3587595)
Genome map
AA seq 76 aa AA seqDB search
MNAKIRYGLSAAVLALIGAGASAPEILDQFLDEKEGNHTTAYRDGAGIWTICRGATRVDG
KPVIPGMKLSKGKRTA
NT seq 231 nt NT seq  +upstreamnt  +downstreamnt
atgaacgcaaaaatcagatacggcctgtcggctgccgttctggcgctgattggtgcaggg
gcgtctgcgcctgaaatcctcgaccagtttctggatgaaaaggaaggtaaccacaccaca
gcataccgtgatggtgcgggtatctggaccatctgccgtggagccacccgggtggatggt
aagcctgtgattcctggcatgaagctgtcgaagggtaagcgtacagcctga

DBGET integrated database retrieval system