KEGG   Ehrlichia chaffeensis Arkansas: ECH_0959Help
Entry
ECH_0959          tRNA      T00328                                 

Definition
(GenBank) tRNA-Trp
  KO
K14235  tRNA Trp
Organism
ech  Ehrlichia chaffeensis Arkansas
Pathway
ech00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:ech00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    ECH_0959
Non-coding RNAs [BR:ech03100]
 Transfer RNA
  tRNA
   ECH_0959
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(983167..983243)
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
aggagtgtagctcaattggctagagcgtcagtctccaaaactgaaggttatgggttcgat
tcctatcactcctgccg

DBGET integrated database retrieval system