KEGG   Escherichia coli K-12 MG1655: b0203Help
Entry
b0203             tRNA      T00007                                 

Gene name
alaV
Definition
(RefSeq) tRNA-Ala
  KO
K14218  
tRNA Ala
Organism
eco  Escherichia coli K-12 MG1655
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:eco00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    b0203 (alaV)
Non-coding RNAs [BR:eco03100]
 Transfer RNA
  tRNA
   b0203 (alaV)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Pasteur: 
RegulonDB: 
EcoGene: 
ECOCYC: 
ASAP: 
Position
225500..225575
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
ggggctatagctcagctgggagagcgcctgctttgcacgcaggaggtctgcggttcgatc
ccgcatagctccacca

DBGET integrated database retrieval system