KEGG   Escherichia coli K-12 MG1655: b0236Help
Entry
b0236             gene      T00007                                 

Gene name
prfH
Definition
(RefSeq) pseudogene
Organism
eco  Escherichia coli K-12 MG1655
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Pasteur: 
EcoGene: 
ASAP: 
Position
253702..254202
Genome map
NT seq 501 nt NT seq  +upstreamnt  +downstreamnt
gtgctggaaacagaaacgggccgctactctgacacactgcgttcggcgctggtttctctc
gatggcgataacgcatgggcattaagcgaaagctggtgtggcactattcagtggatttgt
ccgagtccgtatcggcctcatcatgggcgcaaaaactggtttctgggcattgggcgtttt
accgctgatgagcaggaacaatcggatgcaatccgttatgagacgctgcgttcgtcgggg
ccgggcggtcaacatgtcaataaaaccgactcggcggtacgcgccacgcatttggcatcc
ggtattagcgtgaaggttcagtcagagcgtagtcagcatgctaacaagcggctggcacga
ttgctgattgcctggaagctggagcaacagcaacaggaaaatagcgcggcgctgaaatcg
cagcggcgaatgttccatcaccagattgaacgtggcaacccgcgacggacatttacaggg
atggcttttatcgaaggataa

DBGET integrated database retrieval system