KEGG   Escherichia coli K-12 MG1655: b1715Help
Entry
b1715             CDS       T00007                                 

Gene name
pheM
Definition
(RefSeq) phenylalanyl-tRNA synthetase operon leader peptide
Organism
eco  Escherichia coli K-12 MG1655
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GI: 
NCBI-GeneID: 
Pasteur: 
EcoGene: 
ECOCYC: 
ASAP: 
UniProt: 
Position
complement(1799226..1799270)
Genome map
AA seq 14 aa AA seqDB search
MNAAIFRFFFYFST
NT seq 45 nt NT seq  +upstreamnt  +downstreamnt
atgaatgctgctattttccgcttctttttttactttagcacctga

DBGET integrated database retrieval system