KEGG   Escherichia coli K-12 MG1655: b2238Help
Entry
b2238             gene      T00007                                 

Gene name
yfaH
Definition
(RefSeq) pseudogene
Organism
eco  Escherichia coli K-12 MG1655
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
EcoGene: 
ECOCYC: 
ASAP: 
Position
2349651..2349893
Genome map
NT seq 243 nt NT seq  +upstreamnt  +downstreamnt
cagataaaatgtgaatttaatcaggcggatacagcgatgaattttattcgacagggatta
ggcatcgccttacaaccagagttaacgctgaaaagcattgcaggtgaattgtgttccgtt
cctctcgaaccaactttctatcgacagatttcgttgctggctaaagaaaagccggtagaa
ggcagtccactgtttttactacaaatgtgcatggaacaattagtggcgattggaaaaatt
tga

DBGET integrated database retrieval system