KEGG   Escherichia coli K-12 MG1655: b3268Help
Entry
b3268             gene      T00007                                 

Gene name
yhdW
Definition
(RefSeq) pseudogene
Organism
eco  Escherichia coli K-12 MG1655
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
RegulonDB: 
EcoGene: 
ECOCYC: 
ASAP: 
Position
join(3419042..3419107,3419107..3420066)
Genome map
NT seq 1026 nt NT seq  +upstreamnt  +downstreamnt
atgaaaaagatgatgatagccacactggctgccgccagcgtgctgcttgccgttgcaaat
caggcggctgctggcgcgacgcttgatgccgttcagaaaaaaggttttgtgcaatgcggg
atcagtgatggattacctgggttctcttatgccgatgctgacggtaagttttcaggtatt
gatgttgatatttgtcgtggtgttgccgctgctgtatttggtgacgacacgaaagtgaaa
tataccccgctcactgcaaaagaacgcttcaccgctttacagtcaggggaggtggatttg
ctctcccgtaatacgacctggacttcatctcgcgatgccgggatgggaatggcatttacc
ggcgtcacttattacgacggcattggcttcctgacgcacgataaagcggggctaaaaagc
gcgaaagaactggatggcgctaccgtctgtattcaggcgggtactgataccgaactcaac
gtcgccgactacttcaaggcaaacaatatgaagtacacaccggtgactttcgatcgctct
gacgaatcagcgaaggcactggaatctggtcgctgcgatacgctggcctcggatcaatca
caactgtatgccctgcgcatcaaattaagcaacccagctgaatggattgtcttaccggaa
gttatctcaaaagaaccgcttggtccggtagttcgtcgtggcgatgatgaatggttctcg
attgtacgctggacgcttttcgccatgctgaatgctgaagagatgggcatcaattcccag
aacgtcgatgaaaaagcggctaatccagcaacgcctgatatggcacatctgctgggtaaa
gaaggcgattacggcaaggatctgaagctggataataaatgggcctataacatcatcaaa
caggtgggtaactactcggaaatttttgagcgtaacgtaggttcagaaagcccgctgaaa
attaaacgtgggcaaaataatctctggaataacggcggtattcagtacgcaccgcccgtg
cgttaa

DBGET integrated database retrieval system