KEGG   Escherichia coli K-12 MG1655: b4407Help
Entry
b4407             CDS       T00007                                 

Gene name
thiS
Definition
(RefSeq) immediate sulfur donor in thiazole formation
  KO
K03154  
sulfur carrier protein
Organism
eco  Escherichia coli K-12 MG1655
Pathway
Sulfur relay system
Brite
KEGG Orthology (KO) [BR:eco00001]
 Genetic Information Processing
  Folding, sorting and degradation
   04122 Sulfur relay system
    b4407 (thiS)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif Motif
Other DBs
NCBI-GeneID: 
NCBI-ProteinID: 
Pasteur: 
RegulonDB: 
ECOCYC: 
ASAP: 
UniProt: 
Structure
PDB: 

Jmol
Position
complement(4192637..4192837)
Genome map
AA seq 66 aa AA seqDB search
MQILFNDQAMQCAAGQTVHELLEQLDQRQAGAALAINQQIVPREQWAQHIVQDGDQILLF
QVIAGG
NT seq 201 nt NT seq  +upstreamnt  +downstreamnt
atgcagatcctgtttaacgatcaagcgatgcagtgcgccgccgggcaaactgttcacgaa
ctactggagcaactcgaccaacgacaagcgggcgcggctctggcgattaatcagcaaatc
gtcccgcgtgagcagtgggcgcaacatatcgtgcaggatggcgaccagatcctgcttttt
caggttattgcagggggttga

DBGET integrated database retrieval system