KEGG   Escherichia coli K-12 MG1655: b4414Help
Entry
b4414             ncRNA     T00007                                 

Gene name
tff
Definition
(RefSeq) novel sRNA, function unknown
Organism
eco  Escherichia coli K-12 MG1655
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
EcoGene: 
ECOCYC: 
ASAP: 
Position
189712..189847
Genome map
NT seq 136 nt NT seq  +upstreamnt  +downstreamnt
cggacttccgatccatttcgtatacacagactggacggaagcgacaatctcactttgtgt
aacaacacacacgtatcggcacatattccggggtgccctttggggtcggtaatatgggat
acgtggaggcataacc

DBGET integrated database retrieval system