KEGG   Escherichia coli K-12 MG1655: b4458Help
Entry
b4458             ncRNA     T00007                                 

Gene name
oxyS
Definition
(RefSeq) sRNA antisense regulator activates genes that detoxify oxidative damage, Hfq-dependent
  KO
K18528  small regulatory RNA OxyS
Organism
eco  Escherichia coli K-12 MG1655
Pathway
eco02026  Biofilm formation - Escherichia coli
Brite
KEGG Orthology (KO) [BR:eco00001]
 Cellular Processes
  Cellular community - prokaryotes
   02026 Biofilm formation - Escherichia coli
    b4458 (oxyS)
Messenger RNA biogenesis [BR:eco03019]
 Prokaryotic Type
  Bacterial mRNA degradation factors
   Other RNA degradation factors
    Bacterial Small RNA Regulators
     b4458 (oxyS)
Non-coding RNAs [BR:eco03100]
 Other RNA
  Unclassified
   b4458 (oxyS)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 2847701
Pasteur: oxyS
RegulonDB: ECK120002558
ECOCYC: EG31116
ASAP: ABE-0047276
Position
complement(4158285..4158394)
Genome map
NT seq 110 nt NT seq  +upstreamnt  +downstreamnt
gaaacggagcggcacctcttttaacccttgaagtcactgcccgtttcgagagtttctcaa
ctcgaataactaaagccaacgtgaacttttgcggatctccaggatccgct

DBGET integrated database retrieval system