KEGG   Edwardsiella tarda EIB202: ETAE_1761Help
Entry
ETAE_1761         CDS       T01121                                 

Definition
(GenBank) putative acetyltransferase
Organism
etr  Edwardsiella tarda EIB202
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
Position
complement(1870963..1871175)
Genome map
AA seq 70 aa AA seqDB search
MIEQSILLLKERNIDGLVVLGDPEYYSRFGFHHNHRFIVEGVPAKYFLAQSLININQLPS
GIVTFHKAFE
NT seq 213 nt NT seq  +upstreamnt  +downstreamnt
atgatagaacaatcgattttgttgttaaaagaaagaaatattgatggccttgttgttttg
ggtgacccagagtattactcacgttttggtttccatcataatcatcggttcattgttgag
ggtgttcctgctaaatattttttggcacaatcactaatcaatattaatcaattgccttct
gggatagttacattccataaagctttcgagtaa

DBGET integrated database retrieval system