KEGG   Edwardsiella tarda EIB202: ETAE_1775Help
Entry
ETAE_1775         CDS       T01121                                 

Definition
(GenBank) hypothetical protein
Organism
etr  Edwardsiella tarda EIB202
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: 
Motif
Other DBs
NCBI-ProteinID: 
UniProt: 
Position
complement(1884969..1885211)
Genome map
AA seq 80 aa AA seqDB search
MGIGGLLVVMLSGCASEPAAQTAGARPHIAASAALSEGCALIGGEVALAHQLDGTSLVQC
QLPDGKRCTERGVISGRCPN
NT seq 243 nt NT seq  +upstreamnt  +downstreamnt
atggggatcggggggctgctggtcgtgatgctatcaggctgcgccagcgagcctgcggca
cagacggccggcgcgcggccacatatcgccgccagcgcggcgctgagcgagggatgcgca
ctgatcggcggcgaggtcgcgctggcgcatcagttggacggcacctcgctggtacagtgt
cagctgccggacggcaaacgctgtacggagcggggcgtgatcagcggccgctgccccaac
tga

DBGET integrated database retrieval system