KEGG   Frankia alni: FRAAL2614Help
Entry
FRAAL2614         CDS       T00384                                 

Definition
Formyl-coenzyme A transferase (EC:2.8.3.16)
Orthology
K07749  
formyl-CoA transferase [EC:2.8.3.16]
Organism
fal  Frankia alni
Brite
Enzymes [BR:fal01000]
 2. Transferases
  2.8  Transferring sulfur-containing groups
   2.8.3  CoA-transferases
    2.8.3.16  formyl-CoA transferase
     FRAAL2614
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
RhizoBase: 
UniProt: 
Position
2857341..2857655
Genome map
AA seq 104 aa AA seqDB search
MGGTRGGGWSDEPASNLLDSEAPYYDTYSLGMFLADLDADVIKVEAPPRGDYLRYFLGQL
EPGYSVPHLQVNKNKRSIALDVRADAGREVFWRLLDGAESFLDG
NT seq 315 nt NT seq  +upstreamnt  +downstreamnt
gtgggcgggacgcgcgggggtggctggtcggacgaaccggcgagcaacctgctcgactcc
gaggctccgtactatgacacctacagcctcgggatgttcctcgccgatctcgatgcagat
gtgatcaaggttgaggcgccaccgcggggcgattatctgcgctactttctcggccagctc
gaacccggttacagcgtgccgcatctgcaggtgaacaagaacaagcgctcaatcgcgctg
gacgtgcgcgccgacgctggccgggaggtgttctggcgcctgctggacggtgcggagagc
ttcctcgacggatag

DBGET integrated database retrieval system