KEGG   Felis catus (domestic cat): 101091403Help
Entry
101091403         CDS       T02385                                 

Gene name
SCD
Definition
(RefSeq) acyl-CoA desaturase
  KO
K00507  stearoyl-CoA desaturase (Delta-9 desaturase) [EC:1.14.19.1]
Organism
fca  Felis catus (domestic cat)
Pathway
fca01040  Biosynthesis of unsaturated fatty acids
fca01212  Fatty acid metabolism
fca03320  PPAR signaling pathway
fca04152  AMPK signaling pathway
Brite
KEGG Orthology (KO) [BR:fca00001]
 Metabolism
  Lipid metabolism
   01040 Biosynthesis of unsaturated fatty acids
    101091403 (SCD)
 Environmental Information Processing
  Signal transduction
   04152 AMPK signaling pathway
    101091403 (SCD)
 Organismal Systems
  Endocrine system
   03320 PPAR signaling pathway
    101091403 (SCD)
Enzymes [BR:fca01000]
 1. Oxidoreductases
  1.14  Acting on paired donors, with incorporation or reduction of molecular oxygen
   1.14.19  With oxidation of a pair of donors resulting in the reduction of O2 to two molecules of water
    1.14.19.1  stearoyl-CoA 9-desaturase
     101091403 (SCD)
Lipid biosynthesis proteins [BR:fca01004]
 Desaturase
  First
   101091403 (SCD)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 101091403
NCBI-ProteinID: XP_003994365
Ensembl: ENSFCAG00000031590
UniProt: M3XEI0
Position
D2
AA seq 359 aa AA seqDB search
MPAHLLQEEISSSYTTTTTITAPPSRILQNGGCKLEKPSPYLEEDIRPEIKDDIYDPSYK
DPEGPRPKLQYVWRNIILMSLLHLGALYGIILVPTCKVYTWIWGFFYYVISALGITAGAH
RLWSHRTYKARLPLRFFLIVANTMAFQNDVFEWARDHRAHHKFSETDADPHNSRRGFFFS
HVGWLLVRKHPAVKEKGGLLDLSDLKAEKLVMFQRRYYKPGILLMCFILPTLVPWYFWGE
TFIHSLCVATFLRYAIVLNATWLVNSAAHLYGYRPYDTTISPRENILVSLGAVGEGFHNY
HHSFPYDYSASEYRWHINFTTFFIDCMAFLGLAYDRKKVSKAAILARVKRTGDGSYKSG
NT seq 1080 nt NT seq  +upstreamnt  +downstreamnt
atgccggcccacttgctgcaagaggagatctctagctcctacacaactaccaccaccatc
acagcgcctccctccaggattctgcagaatggagggtgcaagttggagaagccttcccca
tacttggaagaagacatccgccctgaaataaaagatgacatctacgacccaagctacaaa
gatcccgagggcccaaggcccaagcttcagtatgtttggagaaacatcatccttatgtct
ctgctacacttaggagccctctatgggatcatattggttcccacctgcaaggtctacacc
tggatctgggggttcttctactatgtgatcagcgccctgggcataacggcgggagctcat
cgcctatggagtcaccggacttacaaagctcggctgcccctgcggttcttcctgatcgtt
gccaacacgatggcgttccagaatgacgtgtttgaatgggcccgagatcaccgtgctcac
cacaagttttcagaaacagatgctgatcctcacaattcccggcgtggctttttcttctct
cacgtgggttggctgctcgtacgcaaacacccagccgtcaaagagaagggtggtttgcta
gacttgtctgacctaaaagctgagaagctggtgatgttccagagaaggtactacaaaccc
ggcatcctgttgatgtgcttcatcctgcccactcttgtgccctggtatttctggggtgaa
acttttatacacagcttgtgcgtggccactttcttgcgttacgccattgtgctcaatgcc
acctggctggtgaacagcgctgcccacctctacggatatcgcccttatgacaccaccatt
agcccccgagagaatatcctggtttccctgggagctgtaggggagggcttccacaactac
caccactcctttccctatgactactctgccagtgagtaccgctggcacatcaacttcacc
acattcttcatcgactgcatggctttcctcggcctggcttacgaccggaagaaagtatcc
aaggccgccatcctggccagggttaaaagaactggagacggaagctacaagagtggctga

DBGET integrated database retrieval system