KEGG   Fervidobacterium nodosum: Fnod_1609Help
Entry
Fnod_1609         gene      T00579                                 

Definition
pseudogene
Organism
fno  Fervidobacterium nodosum
Class
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
complement(1756834..1757622)
Genome map
NT seq 789 nt NT seq  +upstreamnt  +downstreamnt
ttgattgacttgttcacaccgataggtaaaggacaaaggggaatgatcgtcgctccaccg
aagaccggtaagaccacgatactcaaagaaattgccaacggaattgcaactaaccatcct
gatacaattagaatcgtattactcatcgatgaacgacctgaagaagttacagatatcaaa
gaatcggtagatgcaaaggttatagcagccccgtttgatatgccttccgataagcagata
aaaattgctgaacttacgcttgaaatgtgcaaaagacttgttgaatatggaaatcacgtt
gttgtgctccttgatagtcttacacgacttggaagggtttataacataaccgttccacca
agtggtaaactgttgactggtggtgttgatccggctgcactttacaaacccaaacatttc
ttcggtgctgcaagaaacacaagagaaggtggaagtttaaccatcatcgcaaccgcactc
atagagactggatcgaagatggatgaagtgatatttgaagaattcaaaggtacaggtaat
atggaacttgtgctttcaagacagcttgctaacaaaaggattttcccagccatcaatctt
gcactttcgggtacaagaaaagaagaattattgattgggcaaaacgaattgaagaaagtg
tggatccttaggcgtatgttgagctctatgtctgaagaagaaggtctcaaactcatactt
tcaaaattgaaagaaacgaaatcgaacgaagagttcttagctttaatagacgcccagaaa
acagtataa

DBGET integrated database retrieval system