KEGG   Flavobacterium psychrophilum JIP02/86: FP1024Help
Entry
FP1024            gene      T00548                                 

Definition
(RefSeq) pseudogene
Organism
fps  Flavobacterium psychrophilum JIP02/86
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
1171825..1173258
Genome map
NT seq 1434 nt NT seq  +upstreamnt  +downstreamnt
atgaataataaaaattatttatgtatcctactcttttttttaataacctttaccacattt
gcccaaaacaaggtaggttgtggtgtgaaattatcacaaaaagaagaggttttatttagg
caatcattacctaaattagaaaacttcaaaaacaaagctaataaatccccaacagcttta
ccgtatgtcatccctgttgtatttcacatcttaacagatggtgcagctagttttactaaa
gcagatatgaaatgcagaattgacgatgcgttgcaaattgcaaataaagattttaatggt
ttatttcctggttttttaactactgacccgagatttaatagtgtaaaaagtaaaatggat
attcaatttgtaatggctacagtagatccaactggaaatttaatggaaactccaggatta
gactggcatccagaagcccatataattgatggttataatccagcaatatacaactatatg
tggtatggtagcaactctaaatactatttagatgttgttattgtagatgaacccaataca
ggtcaaggagcttctgggtctgggcatgcctttcttccagtacaaaatgtagtaccacac
gttacatttaattatcgttacattggtagtacttgtgggtcttcgtcttcagtaacattt
gcaaaagttttttcacatgagttaggtcattattttggacttcgccatacttttcaagat
gattgcgacccaattaatgacggtatggccgatacacctcctaccaaagttgccgaagga
tgcactagaaatgtcttaaacagctgcggagtctatgcgaattcagagaatcatatggat
tataatgttgattgtcaaaacatgtttactcttaatcaaacaagcgccatgacattttgg
ctagaagacggaactgttgcaaattatcctagaaaatttctttggcaaccaagcaatctc
atagctactggagttcttgccagtataccaacggcaaattttacggcaaatacaactgca
atatgcccaggtaaaggtattgtttttaaagatatttctttagggttacctgtttctaga
gtatggagtttttcaggaggaagtccatcaacgtcaactgctgttagtcctacagttact
tatgcaacagcaggattataccccgtaactttaaccgtgactaatgctcttggtacaaat
ccaaaaacggtaactaattatataaaagttggacagcctacttctggaaactataccgaa
agttttacaggtattttcccacctaatggatggctaattacaaatccagacgctggttta
gcttgggaaaaaagaagtaatgtaggaaatggtgatactgcgtgtatgattatgaataat
agtgataattctgtattaaatgaaattagattatatacagttgccttattataa

DBGET integrated database retrieval system