KEGG   Flavobacterium psychrophilum JIP02/86: FP2621Help
Entry
FP2621            tRNA      T00548                                 

Definition
(RefSeq) tRNA-Ile
  KO
K14227  
tRNA Ile
Organism
fps  Flavobacterium psychrophilum JIP02/86
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:fps00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    FP2621
Non-coding RNAs [BR:fps03100]
 Transfer RNA
  tRNA
   FP2621
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
1115299..1115375
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
tgtctcgtagctcagctggttagagtactacactgataatgtaggggtcgacagttcgag
tctgtccgagacaacaa

DBGET integrated database retrieval system