KEGG   Flavobacterium psychrophilum JIP02/86: FP2624Help
Entry
FP2624            rRNA      T00548                                 

Gene name
5s_rRNA
Definition
(RefSeq) 5S ribosomal RNA
  KO
K01985  
5S ribosomal RNA
Organism
fps  Flavobacterium psychrophilum JIP02/86
Pathway
Ribosome
Brite
KEGG Orthology (KO) [BR:fps00001]
 Genetic Information Processing
  Translation
   03010 Ribosome
    FP2624 (5s_rRNA)
Ribosome [BR:fps03011]
 Ribosomal RNAs
  Prokaryotes
   FP2624 (5s_rRNA)
Non-coding RNAs [BR:fps03100]
 Ribosomal RNA
  Large subunit rRNA
   FP2624 (5s_rRNA)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
1118865..1118970
Genome map
NT seq 106 nt NT seq  +upstreamnt  +downstreamnt
aggtgattattgcggcggggctcacctcttcccatctcgaacagagaagttaagcccgcc
tgcgcagatggtactgcatttatgtgggagagtatgtcgtcgcctt

DBGET integrated database retrieval system