KEGG   Frankia sp. EuI1c: FraEuI1c_R0044Help
Entry
FraEuI1c_R0044    tmRNA     T01354                                 

Gene name
ssrA
Definition
(GenBank) tmRNA as predicted by Rfam (RF00023), score 186.92
  KO
K15035  
transfer-messenger RNA
Organism
fri  Frankia sp. EuI1c
Brite
Non-coding RNAs [BR:fri03100]
 Other RNA
  Unclassified
   FraEuI1c_R0044 (ssrA)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(7396664..7397035)
Genome map
NT seq 372 nt NT seq  +upstreamnt  +downstreamnt
gggggtgaccggtttcgacttcggacgccacgtcaggggaagcgggccgaggatgaacgg
ttatctcgttaacgatccgttcaaaaaaataactgccaactctgagcagtctgctacttc
cgcttacgccctcgcggcctgacggatataagtagctgtcagcctgggagagcctccggc
ccaggatctggcatcgctaggaggatcacctcgcaacccggtcacggggtagcgcggaac
atcaaacagtgactgggcccacaccggcctgcctgcgggaccggtggggccgagaaatca
agagcaggctgcgcccggagaagccctgatgcgccgccggaggacgcgggttcgattccc
gccacctccacc

DBGET integrated database retrieval system