KEGG   Geitlerinema sp. PCC 7407: GEI7407_2247Help
Entry
GEI7407_2247      gene      T02366                                 

Definition
(GenBank) pseudogene
Organism
gei  Geitlerinema sp. PCC 7407
SSDB OrthologParalogGene clusterGFIT
Position
2768749..2769024
Genome map
NT seq 276 nt NT seq  +upstreamnt  +downstreamnt
gcgatcgccgttccggggtcggtctacgacaaggtgctctccaatgcccaagaggccaag
gcgcgggactcccggctgatcggggtcacggccaccagcgacgcccacgctgccgagatc
tttgacgacatgctgccgattccggcggtgccggagctgctgtcgccggtgctgacggtg
attccgctccagctcttggcgtaccacatcgcggctcgccggggcctcgacgtcgatcag
ccccgcaacctcgccaaatcggtcacggtcgagtag

DBGET integrated database retrieval system