KEGG   Geitlerinema sp. PCC 7407: GEI7407_2251Help
Entry
GEI7407_2251      gene      T02366                                 

Definition
(GenBank) pseudogene
Organism
gei  Geitlerinema sp. PCC 7407
SSDB OrthologParalogGene clusterGFIT
Position
complement(2773630..2773797)
Genome map
NT seq 168 nt NT seq  +upstreamnt  +downstreamnt
atgggtagacagtcatcaacgggaaagttattacagaacccttacggacctataactgtt
ctgtagaatcagtacttcttcctgggagacaacaggaataacagctatgacagctatcta
cggggatttgcaccagagcaaaacaaattggcttcaaactgctactga

DBGET integrated database retrieval system