KEGG   Gallus gallus (chicken): 430227Help
Entry
430227            misc_RNA  T01006                                 

Gene name
ART5
Definition
(RefSeq) ADP-ribosyltransferase 5
Organism
gga  Gallus gallus (chicken)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
CGNC: 
Position
1
NT seq 726 nt NT seq  +upstreamnt  +downstreamnt
gagatcttctgggtcttcccggacagcgggactcaccgcttcgtgctgcggagctccaac
aggacctgcagccacttcaactgcgccttcctgggccatgagaagagccccgagtgcagg
ggcagcacagccattcccgggcacagagacgagctgtgaggggcacagcccagcggcact
gagccctcacctctgcagcaccgcagcccggagctgcacgtgcaccagggatgcatcagg
acagcctgcaccggggcagagccgctcagtgtgctgcgccacgccgcactgcgctgtgtc
acagcctggggacagcagcagcgttcccttgttggtgggggacactgcggctgtgcccgt
ggaagatgtcgtggtgtggctcctgctgctctccccagtgctgcccaaacctgcgggact
gctgtgctgccgccggggcagctctgctgctgctcaccctgcagtgtgcccagcagcacc
cggccctcaggacaaggtctgctttccccactccctcattattccacgctgggtcccgtt
cccattttcggcacttctgcagctcgtgggctcagcccccgaacctctgcggggggctct
gcagctcgtgagctgctgccacggggtgcccaacctcgggcagggtgtgcaggaagctgc
acacaggcgctgcaggaggctgccttctgcgaaatgcattaaaaccacaatcgctcctct
caaaaa

DBGET integrated database retrieval system