KEGG   Geobacillus sp. Y412MC52: GYMC52_R0018Help
Entry
GYMC52_R0018      tRNA      T01399                                 

Definition
tRNA-Gly
Orthology
K14225  
tRNA Gly
Organism
gya  Geobacillus sp. Y412MC52
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:gya00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    GYMC52_R0018
Non-coding RNAs [BR:gya03100]
 Transfer RNA
  tRNA
   GYMC52_R0018
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
90625..90699
Genome map
NT seq 75 nt NT seq  +upstreamnt  +downstreamnt
gcggaagtagttcagcggtagaacaccaccttgccaaggtgggggtcgcgggttcgagtc
ccgtcttccgctcca

DBGET integrated database retrieval system