KEGG   Geobacillus sp. Y412MC52: GYMC52_R0018Help
Entry
GYMC52_R0018      tRNA      T01399                                 

Definition
tRNA-Gly
Orthology
K14225  
tRNA Gly
Organism
gya  Geobacillus sp. Y412MC52
Pathway
Aminoacyl-tRNA biosynthesis
Class
Genetic Information Processing; Translation; Aminoacyl-tRNA biosynthesis [PATH:gya00970]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
90625..90699
Genome map
NT seq 75 nt NT seq  +upstreamnt  +downstreamnt
gcggaagtagttcagcggtagaacaccaccttgccaaggtgggggtcgcgggttcgagtc
ccgtcttccgctcca

DBGET integrated database retrieval system