KEGG   Hyperthermus butylicus: Hbut_0594Help
Entry
Hbut_0594         gene      T00468                                 

Definition
(GenBank) pseudogene
Organism
hbu  Hyperthermus butylicus
SSDB OrthologParalogGene clusterGFIT
Position
complement(562283..563776)
Genome map
NT seq 1494 nt NT seq  +upstreamnt  +downstreamnt
ttggagcggctctacgccgagcctgcatggaggattaccagcctactagtctccggcgat
gtgtctgtcgaggattatgttggctctatctacgagaggattgaaaagctcgaggataag
attaacgcgtacattactcttaggcctcgggagctggtagaggctgaagctaggaaggct
gtggagaaggctcggcggggggagaagcttcccctagctggtgtgctggttgctgtcaag
gataacatccatgttgagggcttacccgtgacatgcggttcaagaatgctggagaagtat
gtggcaccctacgacgctactgtcgtctccaggctgcgtgctgctggcgcagtaatcatc
ggcaagactaacatggatgagtttgcgatggggtctactggcgagaacagcgcctatggg
gcaacaaggaacccgtggagcctggatcgtgtgcctggtgggagcagcagcgggacggcc
gctgcgctcgctgctggcatggcgacgctgggtcttggcagcgacacgggcggcagcata
aggatgccatgcgcatggacagggctctacggtgttaagccgacctacgggctcgtatcc
cgctacggactcgtggcctacgctgatagcctagagcagataggccccatggcccgtaac
gttagggatttggctttgctactggagacgatagcagggtttgacccgagggactctacg
agcctgccagtcgagaaggttgagctactgggggcggttgagaagggctacggtgagggg
ctacgggggctaagggttggagtcgtggaggagttcctagagcatgaaggtgttgacgag
tctgtgaagaaacttgttgagagggctgccgagctgctgggcgaggccgaagctgttgtt
gagcccgtgagacttggaagagaggtgctagagtacagcctccccgcatactacgtggta
gcaatggctgaagcaagcagcaaccttgcaagatacgacggggtacgttacggacctaag
gagcctccagagccgtgggagagctggaaccaatactactcgaggatacgcggcaagtac
tttggcagggaggtcaagctccgcataatgcttggcgcatggatgcttagcagcggctac
aaggaccaatactatgtccgcgcactcaaactacgggcactggtgcgcaggagactacta
cagctcctccaggcacatgacctactcctagcaccagccgtcgttacaccgccccctagg
ctcggcgaggtagtggaggatcctgcaaagatgtatgcgttagaccttgcaacagttacc
gcaaacctagctggcataccggctggcacagcacctgttggctacgtggatggggtgccg
ctaggggtacagctcatggctcggcccctcgccgaacaaacactcatccagggcctcgca
gccctcgagaggctatccgggctccataaccttgtagccgagcctgccacctag

DBGET integrated database retrieval system