KEGG   Haemophilus influenzae PittEE (nontypeable): CGSHiEE_t09424Help
Entry
CGSHiEE_t09424    tRNA      T00543                                 

Definition
(GenBank) tRNA-Gln
  KO
K14223  
tRNA Gln
Organism
hip  Haemophilus influenzae PittEE (nontypeable)
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:hip00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    CGSHiEE_t09424
Non-coding RNAs [BR:hip03100]
 Transfer RNA
  tRNA
   CGSHiEE_t09424
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(1157445..1157519)
Genome map
NT seq 75 nt NT seq  +upstreamnt  +downstreamnt
tggggtatcgccaagcggtaaggcactgggttttgatctcagcattcctaggttcgaatc
ctagtaccccagcca

DBGET integrated database retrieval system