KEGG   Halalkalicoccus jeotgali: HacjB3_08295Help
Entry
HacjB3_08295      CDS       T01271                                 

Definition
(GenBank) hypothetical protein
Organism
hje  Halalkalicoccus jeotgali
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ADJ15042
UniProt: D8J2T5
Position
complement(1530881..1531018)
Genome map
AA seq 45 aa AA seqDB search
MANLLAVDGLIAHTGSTPGRGVRVSDQATRAQTTSAEGNTMIDAR
NT seq 138 nt NT seq  +upstreamnt  +downstreamnt
gtggcgaacctcctcgccgtcgacggactgatcgctcataccggaagcacccccggacgg
ggagtaagggtttcggatcaggcgacgcgcgcccagaccaccagcgccgagggcaacacg
atgatcgacgccagatag

DBGET integrated database retrieval system