KEGG   Homo sapiens (human): 100144748Help
Entry
100144748         CDS       T01001                                 

Gene name
KLLN, CWS4, KILLIN
Definition
killin, p53-regulated DNA replication inhibitor
Organism
hsa  Homo sapiens (human)
Class
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
OMIM: 
HGNC: 
Ensembl: 
Vega: 
UniProt: 
Position
10q23
AA seq 178 aa AA seqDB search
MDRPGPGSARPGRTVHVWGYRVEWKVRNGRKLQPSEWAGRGDLGGFKRRWKDTRATVGTT
FRRRSRVSLVGELSKFPLPSDSSGGKSSSSFARGALAWCRQRNPNPSCAAAETGARTSLP
KERCRGWRLGNWLHKHPHPNTCPRLPACWLPPILTERGERVPKLVPLLACYPKSKPKD
NT seq 537 nt NT seq  +upstreamnt  +downstreamnt
atggatcgcccggggccaggctccgcgcgccccggccggaccgtgcacgtttggggttac
cgggttgagtggaaagtacggaacggtaggaagctgcagcccagcgagtgggcggggcga
ggagacctaggagggttcaaaaggaggtggaaggatacacgggccacagtcggaactact
ttccgaaggaggtcacgtgtgtccctagttggggaactttccaaattcccactccccagt
gatagctccggaggcaagtcgtcttcttcctttgctcggggtgctcttgcctggtgcagg
cagcggaaccccaacccttcctgcgccgcggcggaaacaggggctcggaccagcctcccg
aaggagcgctgtcggggctggcgcttggggaactggttacacaagcacccacatccaaac
acgtgcccccgcctccccgcctgctggctgccgccgattcttacagaacgcggggagaga
gtccccaaactggtgccactcctcgcctgctaccctaagagcaagccaaaggactga

DBGET integrated database retrieval system