KEGG   Homo sapiens (human): 161497Help
Entry
161497            CDS       T01001                                 

Gene name
STRC, DFNB16
Definition
stereocilin
Organism
hsa  Homo sapiens (human)
Disease
H00605  
Deafness, autosomal recessive
SSDB OrthologParalogGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
OMIM: 
HGNC: 
HPRD: 
Ensembl: 
Vega: 
UniProt: 
Position
15q15.3
AA seq 1775 aa AA seqDB search
MALSLWPLLLLLLLLLLLSFAVTLAPTGPHSLDPGLSFLKSLLSTLDQAPQGSLSRSRFF
TFLANISSSFEPGRMGEGPVGEPPPLQPPALRLHDFLVTLRGSPDWEPMLGLLGDMLALL
GQEQTPRDFLVHQAGVLGGLVEVLLGALVPGGPPTPTRPPCTRDGPSDCVLAADWLPSLL
LLLEGTRWQALVQVQPSVDPTNATGLDGREAAPHFLQGLLGLLTPTGELGSKEALWGGLL
RTVGAPLYAAFQEGLLRVTHSLQDEVFSILGQPEPDTNGQCQGGNLQQLLLWGVRHNLSW
DVQALGFLSGSPPPPPALLHCLSTGVPLPRASQPSAHISPRQRRAITVEALCENHLGPAP
PYSISNFSIHLLCQHTKPATPQPHPSTTAICQTAVWYAVSWAPGAQGWLQACHDQFPDEF
LDAICSNLSFSALSGSNRRLVKRLCAGLLPPPTSCPEGLPPVPLTPDIFWGCFLENETLW
AERLCGEASLQAVPPSNQAWVQHVCQGPTPDVTASPPCHIGPCGERCPDGGSFLVMVCAN
DTMYEVLVPFWPWLAGQCRISRGGNDTCFLEGLLGPLLPSLPPLGPSPLCLTPGPFLLGM
LSQLPRCQSSVPALAHPTRLHYLLRLLTFLLGPGAGGAEAQGMLGRALLLSSLPDNCSFW
DAFRPEGRRSVLRTIGEYLEQDEEQPTPSGFEPTVNPSSGISKMELLACFSPVLWDLLQR
EKSVWALQILVQAYLHMPPENLQQLVLSAEREAAQGFLTLMLQGKLQGKLQVPPSEEQAL
GRLTALLLQRYPRLTSQLFIDLSPLIPFLAVSDLMRFPPSLLANDSVLAAIRDYSPGMRP
EQKEALAKRLLAPELFGEVPAWPQELLWAVLPLLPHLPLENFLQLSPHQIQALEDSWPAA
GLGPGHARHVLRSLVNQSVQDGEEQVRRLGPLACFLSPEELQSLVPLSDPTGPVERGLLE
CAANGTLSPEGRVAYELLGVLRSSGGAVLSPRELRVWAPLFSQLGLRFLQELSEPQLRAM
LPVLQGTSVTPAQAVLLLGRLLPRHDLSLEELCSLHLLLPGLSPQTLQAIPRRVLVGACS
CLAPELSRLSACQTAALLQTFRVKDGVKNMGTTGAGPAVCIPGQPIPTTWPDCLLPLLPL
KLLQLDSLALLANRRRYWELPWSEQQAQFLWKKMQVPTNLTLRNLQALGTLAGGMSCEFL
QQINSMVDFLEVVHMIYQLPTRVRGSLRACIWAELQRRMAMPEPEWTTVGPELNGLDSKL
LLDLPIQLMDRLSNESIMLVVELVQRAPEQLLALTPLHQAALAERALQNLAPKETPVSGE
VLETLGPLVGFLGTESTRQIPLQILLSHLSQLQGFCLGETFATELGWLLLQESVLGKPEL
WSQDEVEQAGRLVFTLSTEAISLIPREALGPETLERLLEKQQSWEQSRVGQLCREPQLAA
KKAALVAGVVRPAAEDLPEPVPNCADVRGTFPAAWSATQIAEMELSDFEDCLTLFAGDPG
LGPEELRAAMGKAKQLWGPPRGFRPEQILQLGRLLIGLGDRELQELILVDWGVLSTLGQI
DGWSTTQLRIVVSSFLRQSGRHVSHLDFVHLTALGYTLCGLRPEELQHISSWEFSQAALF
LGTLHLQCSEEQLEVLAHLLVLPGGFGPISNWGPEIFTEIGTIAAGIPDLALSALLRGQI
QGVTPLAISVIPPPKFAVVFSPIQLSSLTSAQAVAVTPEQMAFLSPEQRRAVAWAQHEGK
ESPEQQGRSTAWGLQDWSRPSWSLVLTISFLGHLL
NT seq 5328 nt NT seq  +upstreamnt  +downstreamnt
atggctctcagcctctggcccctgctgctgctgctgctgctgctgctgctgctgtccttt
gcagtgactctggcccctactgggcctcattccctggaccctggtctctccttcctgaag
tcattgctctccactctggaccaggctccccagggctccctgagccgctcacggttcttt
acattcctggccaacatttcttcttcctttgagcctgggagaatgggggaaggaccagta
ggagagcccccacctctccagccgcctgctctgcggctccatgattttctagtgacactg
agaggtagccccgactgggagccaatgctagggctgctaggggatatgctggcactgctg
ggacaggagcagactccccgagatttcctggtgcaccaggcaggggtgctgggtggactt
gtggaggtgctgctgggagccttagttcctgggggcccccctaccccaactcggccccca
tgcacccgtgatgggccgtctgactgtgtcctggctgctgactggttgccttctctgctg
ctgttgttagagggcacacgctggcaagctctggtgcaggtgcagcccagtgtggacccc
accaatgccacaggcctcgatgggagggaggcagctcctcactttttgcagggtctgttg
ggtttgcttaccccaacaggggagctaggctccaaggaggctctttggggcggtctgcta
cgcacagtgggggcccccctctatgctgcctttcaggaggggctgctccgtgtcactcac
tccctgcaggatgaggtcttctccattttggggcagccagagcctgataccaatgggcag
tgccagggaggtaaccttcaacagctgctcttatggggcgtccggcacaacctttcctgg
gatgtccaggcgctgggctttctgtctggatcaccacccccaccccctgccctccttcac
tgcctgagcacgggcgtgcctctgcccagagcttctcagccgtcagcccacatcagccca
cgccaacggcgagccatcactgtggaggccctctgtgagaaccacttaggcccagcacca
ccctacagcatttccaacttctccatccacttgctctgccagcacaccaagcctgccact
ccacagccccatcccagcaccactgccatctgccagacagctgtgtggtatgcagtgtcc
tgggcaccaggtgcccaaggctggctacaggcctgccacgaccagtttcctgatgagttt
ttggatgcgatctgcagtaacctctccttttcagccctgtctggctccaaccgccgcctg
gtgaagcggctctgtgctggcctgctcccaccccctaccagctgccctgaaggcctgccc
cctgttcccctcaccccagacatcttttggggctgcttcttggagaatgagactctgtgg
gctgagcgactgtgtggggaggcaagtctacaggctgtgccccccagcaaccaggcttgg
gtccagcatgtgtgccagggccccaccccagatgtcactgcctccccaccatgccacatt
ggaccctgtggggaacgctgcccggatgggggcagcttcctggtgatggtctgtgccaat
gacaccatgtatgaggtcctggtgcccttctggccttggctagcaggccaatgcaggata
agtcgtgggggcaatgacacttgcttcctagaagggctgctgggcccccttctgccctct
ctgccaccactgggaccatccccactctgtctgacccctggccccttcctccttggcatg
ctatcccagttgccacgctgtcagtcctctgtcccagctcttgctcaccccacacgccta
cactatctcctccgcctgctgaccttcctcttgggtccaggggctgggggcgctgaggcc
caggggatgctgggtcgggccctactgctctccagtctcccagacaactgctccttctgg
gatgcctttcgcccagagggccggcgcagtgtgctacggacgattggggaatacctggaa
caagatgaggagcagccaaccccatcaggctttgaacccactgtcaaccccagctctggt
ataagcaagatggagctgctggcctgctttagtcctgtgctgtgggatctgctccagagg
gaaaagagtgtttgggccctgcagattctagtgcaggcgtacctgcatatgcccccagaa
aacctccagcagctggtgctttcagcagagagggaggctgcacagggcttcctgacactc
atgctgcaggggaagctgcaggggaagctgcaggtaccaccatccgaggagcaggccctg
ggtcgcctgacagccctgctgctccagcggtacccacgcctcacctcccagctcttcatt
gacctgtcaccactcatccctttcttggctgtctctgacctgatgcgcttcccaccatcc
ctgttagccaacgacagtgtcctggctgccatccgggattacagcccaggaatgaggcct
gaacagaaggaggctctggcaaagcgactgctggcccctgaactgtttggggaagtgcct
gcctggccccaggagctgctgtgggcagtgctgcccctgctcccccacctccctctggag
aactttttgcagctcagccctcaccagatccaggccctggaggatagctggccagcagca
ggtctggggccagggcatgcccgccatgtgctgcgcagcctggtaaaccagagtgtccag
gatggtgaggagcaggtacgcaggcttgggcccctcgcctgtttcctgagccctgaggag
ctgcagagcctagtgcccctgagtgatccaacggggccagtagaacgggggctgctggaa
tgtgcagccaatgggaccctcagcccagaaggacgggtggcatatgaacttctgggtgtg
ttgcgctcatctggaggagcggtgctgagcccccgggagctgcgggtctgggcccctctc
ttctctcagctgggcctccgcttccttcaggagctgtcagagccccagcttagagccatg
cttcctgtcctgcagggaactagtgttacacctgctcaggctgtcctgctgcttggacgg
ctccttcctaggcacgatctatccctggaggaactctgctccttgcaccttctgctacca
ggcctcagcccccagacactccaggccatccctaggcgagtcctggtcggggcttgttcc
tgcctggcccctgaactgtcacgcctctcagcctgccagaccgcagcactgctgcagacc
tttcgggttaaagatggtgttaaaaatatgggtacaacaggtgctggtccagctgtgtgt
atccctggtcagcctattcccaccacctggccagactgcctgcttcccctgctcccatta
aagctgctacaactggattccttggctcttctggcaaatcgaagacgctactgggagctg
ccctggtctgagcagcaggcacagtttctctggaagaagatgcaagtacccaccaacctt
accctcaggaatctgcaggctctgggcaccctggcaggaggcatgtcctgtgagtttctg
cagcagatcaactccatggtagacttccttgaagtggtgcacatgatctatcagctgccc
actagagttcgagggagcctgagggcctgtatctgggcagagctacagcggaggatggca
atgccagaaccagaatggacaactgtagggccagaactgaacgggctggatagcaagcta
ctcctggacttaccgatccagttgatggacagactatccaatgaatccattatgttggtg
gtggagctggtgcaaagagctccagagcagctgctggcactgacccccctccaccaggca
gccctggcagagagggcactacaaaacctggctccaaaggagactccagtctcaggggaa
gtgctggagaccttaggccctttggttggattcctggggacagagagcacacgacagatc
cccctacagatcctgctgtcccatctcagtcagctgcaaggcttctgcctaggagagaca
tttgccacagagctgggatggctgctattgcaggagtctgttcttgggaaaccagagttg
tggagccaggatgaagtagagcaagctggacgcctagtattcactctgtctactgaggca
atttccttgatccccagggaggccttgggtccagagaccctggagcggcttctagaaaag
cagcagagctgggagcagagcagagttggacagctgtgtagggagccacagcttgctgcc
aagaaagcagccctggtagcaggggtggtgcgaccagctgctgaggatcttccagaacct
gtgccaaattgtgcagatgtacgagggacattcccagcagcctggtctgcaacccagatt
gcagagatggagctctcagactttgaggactgcctgacattatttgcaggagacccagga
cttgggcctgaggaactgcgggcagccatgggcaaagcaaaacagttgtggggtcccccc
cggggatttcgtcctgagcagatcctgcagcttggtaggctcttaataggtctaggagat
cgggaactacaggagctgatcctagtggactggggagtgctgagcaccctggggcagata
gatggctggagcaccactcagctccgcattgtggtctccagtttcctacggcagagtggt
cggcatgtgagccacctggacttcgttcatctgacagcgctgggttatactctctgtgga
ctgcggccagaggagctccagcacatcagcagttgggagttcagccaagcagctctcttc
ctcggcaccctgcatctccagtgctctgaggaacaactggaggttctggcccacctactt
gtactgcctggtgggtttggcccaatcagtaactgggggcctgagatcttcactgaaatt
ggcaccatagcagctgggatcccagacctggctctttcagcactgctgcggggacagatc
cagggcgttactcctcttgccatttctgtcatccctcctcctaaatttgctgtggtgttt
agtcccatccaactatctagtctcaccagtgctcaggctgtggctgtcactcctgagcaa
atggcctttctgagtcctgagcagcgacgagcagttgcatgggcccaacatgagggaaag
gagagcccagaacagcaaggtcgaagtacagcctggggcctccaggactggtcacgacct
tcctggtccctggtattgactatcagcttccttggccacctgctatga

DBGET integrated database retrieval system