KEGG   Homo sapiens (human): 387715Help
Entry
387715            CDS       T01001                                 

Gene name
ARMS2, ARMD8
Definition
(RefSeq) age-related maculopathy susceptibility 2
Organism
hsa  Homo sapiens (human)
Disease
H00821  Age-related macular degeneration
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 387715
NCBI-ProteinID: NP_001093137
OMIM: 611313
HGNC: 32685
Ensembl: ENSG00000254636
Vega: OTTHUMG00000048232
Pharos: P0C7Q2(Tbio)
UniProt: P0C7Q2
Position
10q26.13
AA seq 107 aa AA seqDB search
MLRLYPGPMVTEAEGKGGPEMASLSSSVVPVSFISTLRESVLDPGVGGEGASDKQRSKLS
LSHSMIPAAKIHTELCLPAFFSPAGTQRRFQQPQHHLTLSIIHTAAR
NT seq 324 nt NT seq  +upstreamnt  +downstreamnt
atgctgcgcctatacccaggaccgatggtaactgaggcggaggggaaaggagggcctgag
atggcaagtctgtcctcctcggtggttcctgtgtccttcatttccactctgcgagagtct
gtgctggaccctggagttggtggagaaggagccagtgacaagcagaggagcaaactgtct
ttatcacactccatgatcccagctgctaaaatccacactgagctctgcttaccagccttc
ttctctcctgctggaacccagaggaggttccagcagcctcagcaccacctgacactgtct
atcatccacactgcagcaaggtga

DBGET integrated database retrieval system