KEGG   Homo sapiens (human): 387715Help
Entry
387715            CDS       T01001                                 

Gene name
ARMS2, ARMD8
Definition
age-related maculopathy susceptibility 2
Organism
hsa  Homo sapiens (human)
Disease
H00821  
Macular degeneration
Class
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
OMIM: 
HGNC: 
Ensembl: 
Vega: 
UniProt: 
Position
10q26.13
AA seq 107 aa AA seqDB search
MLRLYPGPMVTEAEGKGGPEMASLSSSVVPVSFISTLRESVLDPGVGGEGASDKQRSKLS
LSHSMIPAAKIHTELCLPAFFSPAGTQRRFQQPQHHLTLSIIHTAAR
NT seq 324 nt NT seq  +upstreamnt  +downstreamnt
atgctgcgcctatacccaggaccgatggtaactgaggcggaggggaaaggagggcctgag
atggcaagtctgtcctcctcggtggttcctgtgtccttcatttccactctgcgagagtct
gtgctggaccctggagttggtggagaaggagccagtgacaagcagaggagcaaactgtct
ttatcacactccatgatcccagctgctaaaatccacactgagctctgcttaccagccttc
ttctctcctgctggaacccagaggaggttccagcagcctcagcaccacctgacactgtct
atcatccacactgcagcaaggtga

DBGET integrated database retrieval system