KEGG   Homo sapiens (human): 4014Help
Entry
4014              CDS       T01001                                 

Gene name
LOR
Definition
loricrin
Orthology
K10385  
loricrin
Organism
hsa  Homo sapiens (human)
Disease
H00714  
Vohwinkel syndrome
SSDB OrthologParalogGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
OMIM: 
HGNC: 
HPRD: 
Ensembl: 
Vega: 
UniProt: 
Position
1q21
AA seq 312 aa AA seqDB search
MSYQKKQPTPQPPVDCVKTSGGGGGGGGSGGGGCGFFGGGGSGGGSSGSGCGYSGGGGYS
GGGCGGGSSGGGGGGGIGGCGGGSGGSVKYSGGGGSSGGGSGCFSSGGGGSGCFSSGGGG
SSGGGSGCFSSGGGGSSGGGSGCFSSGGGGFSGQAVQCQSYGGVSSGGSSGGGSGCFSSG
GGGGSVCGYSGGGSGCGGGSSGGSGSGYVSSQQVTQTSCAPQPSYGGGSSGGGGSGGSGC
FSSGGGGGSSGCGGGSSGIGSGCIISGGGSVCGGGSSGGGGGGSSVGGSGSGKGVPICHQ
TQQKQAPTWPSK
NT seq 939 nt NT seq  +upstreamnt  +downstreamnt
atgtcttatcagaaaaagcagcccacccctcagcccccagtggactgcgtgaagacctct
ggcggcggtggcggtggcggcggcagcggcggtggtggctgcggcttcttcggcggcggc
ggctcagggggcggtagcagcggttctggctgcggctactccggcggcggtggctactct
ggcggcggctgcggcgggggctcctccggcggcgggggcgggggcggcattggaggctgc
ggagggggctccggtgggagcgtcaagtactccggaggcggcggctcctccggcgggggc
tctggctgtttctccagcggtgggggcggctccggctgcttctcctccggtggcggcggc
tcctccgggggcggctccggctgcttctccagcggtgggggcggctcctccgggggcggc
tccggctgcttctcctccggcggcggcggcttctcgggccaggcggtccagtgccagagc
tacggaggcgtctctagcggcggctcctccgggggcggctccggctgcttctccagcggc
gggggcggcggctctgtctgcggctactctggcggcggctctggctgcggcggaggctcc
tctggcggcagcggctccggctacgtctcctcgcagcaggtcactcagacctcgtgcgcg
ccccagccgagttacggaggggggtcgtccggcggcggcggcagcggcggaagcggctgc
ttctccagcggcgggggcggcgggagctccggctgcggcggcggctcctccgggattggc
agcggctgcatcatcagtggcgggggctccgtctgcggaggtggttcctctggaggcggc
ggcggcggctcctccgtgggtggctccgggagtggcaagggcgtcccgatctgccaccag
acccagcagaagcaggcgcctacctggccgtccaaatag

  All links  
No link information was found.   
DBGET integrated database retrieval system