KEGG   Homo sapiens (human): 5619Help
Entry
5619              CDS       T01001                                 

Gene name
PRM1, CT94.1, P1
Definition
(RefSeq) protamine 1
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Motif Motif
Other DBs
NCBI-ProteinID: 
NCBI-GeneID: 
OMIM: 
HGNC: 
HPRD: 
Ensembl: 
Vega: 
UniProt: 
Position
16p13.2
AA seq 51 aa AA seqDB search
MARYRCCRSQSRSRYYRQRQRSRRRRRRSCQTRRRAMRCCRPRYRPRCRRH
NT seq 156 nt NT seq  +upstreamnt  +downstreamnt
atggccaggtacagatgctgtcgcagccagagccggagcagatattaccgccagagacaa
agaagtcgcagacgaaggaggcggagctgccagacacggaggagagccatgaggtgctgc
cgccccaggtacagaccgcgatgtagaagacactaa

DBGET integrated database retrieval system