KEGG   Homo sapiens (human): 5619Help
Entry
5619              CDS       T01001                                 

Gene name
PRM1, CT94.1, P1
Definition
(RefSeq) protamine 1
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Motif
Pfam: Protamine_P1
Motif
Other DBs
NCBI-GeneID: 5619
NCBI-ProteinID: NP_002752
OMIM: 182880
HGNC: 9447
Ensembl: ENSG00000175646
Vega: OTTHUMG00000090521
Pharos: P04553(Tbio)
UniProt: P04553 Q3MN80
Position
16p13.13
AA seq 51 aa AA seqDB search
MARYRCCRSQSRSRYYRQRQRSRRRRRRSCQTRRRAMRCCRPRYRPRCRRH
NT seq 156 nt NT seq  +upstreamnt  +downstreamnt
atggccaggtacagatgctgtcgcagccagagccggagcagatattaccgccagagacaa
agaagtcgcagacgaaggaggcggagctgccagacacggaggagagccatgaggtgctgc
cgccccaggtacagaccgcgatgtagaagacactaa

DBGET integrated database retrieval system