KEGG   Homo sapiens (human): 100144748Help
Entry
100144748         CDS       T01001                                 

Gene name
KLLN, CWS4, KILLIN
Definition
(RefSeq) killin, p53 regulated DNA replication inhibitor
Organism
hsa  Homo sapiens (human)
Disease
H01222  
Cowden syndrome
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
NCBI-ProteinID: 
OMIM: 
HGNC: 
Ensembl: 
Vega: 
Pharos: 
B2CW77(Tbio)
UniProt: 
Position
10q23.31
AA seq 178 aa AA seqDB search
MDRPGPGSARPGRTVHVWGYRVEWKVRNGRKLQPSEWAGRGDLGGFKRRWKDTRATVGTT
FRRRSRVSLVGELSKFPLPSDSSGGKSSSSFARGALAWCRQRNPNPSCAAAETGARTSLP
KERCRGWRLGNWLHKHPHPNTCPRLPACWLPPILTERGERVPKLVPLLACYPKSKPKD
NT seq 537 nt NT seq  +upstreamnt  +downstreamnt
atggatcgcccggggccaggctccgcgcgccccggccggaccgtgcacgtttggggttac
cgggttgagtggaaagtacggaacggtaggaagctgcagcccagcgagtgggcggggcga
ggagacctaggagggttcaaaaggaggtggaaggatacacgggccacagtcggaactact
ttccgaaggaggtcacgtgtgtccctagttggggaactttccaaattcccactccccagt
gatagctccggaggcaagtcgtcttcttcctttgctcggggtgctcttgcctggtgcagg
cagcggaaccccaacccttcctgcgccgcggcggaaacaggggctcggaccagcctcccg
aaggagcgctgtcggggctggcgcttggggaactggttacacaagcacccacatccaaac
acgtgcccccgcctccccgcctgctggctgccgccgattcttacagaacgcggggagaga
gtccccaaactggtgccactcctcgcctgctaccctaagagcaagccaaaggactga

DBGET integrated database retrieval system