KEGG   Homo sapiens (human): 100169758Help
Entry
100169758         rRNA      T01001                                 

Gene name
RNA5S7, RN5S7
Definition
(RefSeq) RNA, 5S ribosomal 7
  KO
K01981  
large subunit ribosomal RNA, 5S
Organism
hsa  Homo sapiens (human)
Pathway
Ribosome biogenesis in eukaryotes
Ribosome
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Genetic Information Processing
  Translation
   03010 Ribosome
    100169758 (RNA5S7)
   03008 Ribosome biogenesis in eukaryotes
    100169758 (RNA5S7)
Ribosome [BR:hsa03011]
 Ribosomal RNAs
  Eukaryotes
   100169758 (RNA5S7)
Non-coding RNAs [BR:hsa03100]
 Ribosomal RNA
  Large subunit rRNA
   100169758 (RNA5S7)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
HGNC: 
Ensembl: 
Position
1q42.13
NT seq 121 nt NT seq  +upstreamnt  +downstreamnt
gtctacggccataccaccctgaacgcgcccgatctcgtctgatctcggaagctaagcagg
gtcgggcctggttagtacttggatgggagaccgcctgggaataccgggtgctgtaggctt
t

DBGET integrated database retrieval system