KEGG   Homo sapiens (human): 100169763Help
Entry
100169763         rRNA      T01001                                 

Gene name
RNA5S12, RN5S12
Definition
(RefSeq) RNA, 5S ribosomal 12
  KO
K01981  
large subunit ribosomal RNA, 5S
Organism
hsa  Homo sapiens (human)
Pathway
Ribosome biogenesis in eukaryotes
Ribosome
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Genetic Information Processing
  Translation
   03010 Ribosome
    100169763 (RNA5S12)
   03008 Ribosome biogenesis in eukaryotes
    100169763 (RNA5S12)
Ribosome [BR:hsa03011]
 Ribosomal RNAs
  Eukaryotes
   100169763 (RNA5S12)
Non-coding RNAs [BR:hsa03100]
 Ribosomal RNA
  Large subunit rRNA
   100169763 (RNA5S12)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
HGNC: 
Ensembl: 
Position
1q42.13
NT seq 121 nt NT seq  +upstreamnt  +downstreamnt
gtctacggccataccaccctgaacgcgcccgatctcgtctgatctcggaagctaagcagg
gtcgggcctggttagtacttggatgggagaccgcctgggaataccgggtgctgtaggctt
t

DBGET integrated database retrieval system