KEGG   Homo sapiens (human): 100169767Help
Entry
100169767         rRNA      T01001                                 

Gene name
RNA5S16, RN5S16
Definition
(RefSeq) RNA, 5S ribosomal 16
  KO
K01981  
large subunit ribosomal RNA, 5S
Organism
hsa  Homo sapiens (human)
Pathway
Ribosome biogenesis in eukaryotes
Ribosome
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Genetic Information Processing
  Translation
   03010 Ribosome
    100169767 (RNA5S16)
   03008 Ribosome biogenesis in eukaryotes
    100169767 (RNA5S16)
Ribosome [BR:hsa03011]
 Ribosomal RNAs
  Eukaryotes
   100169767 (RNA5S16)
Non-coding RNAs [BR:hsa03100]
 Ribosomal RNA
  Large subunit rRNA
   100169767 (RNA5S16)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
HGNC: 
Ensembl: 
Position
1q42.13
NT seq 121 nt NT seq  +upstreamnt  +downstreamnt
gtctacggccataccaccctgaacgcgcccgatctcgtctgatctcggaagctaagcagg
gtcgggcctggttagtacttggatgggagaccgcctgggaataccgggtgctgtaggctt
t

DBGET integrated database retrieval system