KEGG   Homo sapiens (human): 130540Help
Entry
130540            CDS       T01001                                 

Gene name
ALS2CR12
Definition
(RefSeq) amyotrophic lateral sclerosis 2 chromosome region candidate 12
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GeneID: 
HGNC: 
HPRD: 
Ensembl: 
Vega: 
UniProt: 
Position
2q33.1
AA seq 445 aa AA seqDB search
MYPNPLIYCTCWDPWNLGPRKLIKTPQLPRKNSTGSSKLTPLVPAPKNHNYLQPTKPVVS
PKMKIHSARQEETNKSFYEVINVSPGYQLVRNREQISVTLGDEMFDRKKRWESEIPDKGR
FSRTNIISDLEEQISELTAIIEQMNRDHQSAQKLLSSEMDLRCAEMKQNFENKNRELKEA
HEAELSELENNYKAALKAEKLAAQEKLEEMGKEYKYLKNMFRTYQDSIYDEMEEKWSKQK
AKWKKDEKFERENILLQQKKKMTKKFEMESGEEDKKINESCSAVFENFIQEKEELLKQHQ
SDTLQLEELRKTKEVPWRRDQINRHWHDVLQQLLLMQVMQEELHAQALILESLNTNLYYT
QLELQKEKAIVGNLEKMLQTKFAETEEKYKHTIQILTEENIHLKQKIISKNEEICEGCSG
RLASITVSKDDSDTVQDGSKKGQES
NT seq 1338 nt NT seq  +upstreamnt  +downstreamnt
atgtaccccaaccctctcatctactgcacctgctgggacccctggaacttgggaccacgg
aagctaatcaagacccctcaactaccacgcaagaactccacagggagttccaagctaact
cctcttgtaccagctccaaaaaatcacaattacctccaaccaacaaaacctgttgtttcc
ccaaaaatgaaaatccattcagcaaggcaagaagagactaataaatcattttatgaagtg
atcaacgtgtcacctggctatcaacttgttcggaatcgggaacagatttctgtcacctta
ggggatgagatgtttgataggaaaaagcggtgggaatcggagatcccggacaaaggcaga
ttttccaggaccaacatcatttctgacctagaagagcaaatctcagagctgacagcaata
attgaacaaatgaacagagaccaccagtctgcccagaaattgctctccagtgaaatggat
ctccgctgtgctgagatgaaacagaactttgaaaacaagaacagggagctcaaagaggcc
catgaagcagaactcagtgagttggagaacaactacaaagcagccttgaaggcagagaag
ttggctgcccaagagaagctagaggagatgggaaaagaatacaagtatttgaagaatatg
tttcgtacgtatcaggacagtatttatgatgaaatggaagagaagtggtcaaaacagaag
gcgaaatggaagaaggatgagaagttcgagcgagaaaatatcctgctacagcaaaaaaaa
aagatgaccaaaaaattcgaaatggagtcaggagaagaagataagaaaataaatgaatcc
tgcagtgctgtctttgagaacttcattcaagagaaggaggagctcttgaaacaacatcaa
agtgacaccttgcaattagaagagctgagaaaaaccaaagaggtgccctggagaagagac
caaataaatagacattggcatgatgtcctgcaacagcttcttcttatgcaggtcatgcag
gaagaattgcatgcacaagcccttatcctagagtcactgaacacaaacctctactatacc
cagttggaactccagaaagagaaagctatagtgggaaatctggagaaaatgcttcaaacc
aagtttgctgaaactgaagaaaagtataagcacaccatacagatcctgacggaagagaac
attcatctgaagcaaaagataatttctaagaatgaagaaatttgtgaaggatgttctggg
agattggcctctattactgtttctaaggatgattctgacactgtgcaagatggtagcaag
aaaggacaagaatcataa

DBGET integrated database retrieval system