KEGG   Homo sapiens (human): 130872Help
Entry
130872            misc_RNA  T01001                                 

Gene name
AHSA2P, AHA1, AHSA2, Hch1
Definition
(RefSeq) activator of HSP90 ATPase homolog 2, pseudogene
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Motif Motif
Other DBs
NCBI-GeneID: 
HGNC: 
Ensembl: 
Vega: 
Pharos: 
Q719I0(Tdark)
Position
2p15
NT seq 3177 nt NT seq  +upstreamnt  +downstreamnt
gccttctggcagtttctgggagctgcgaacgcgccgccccggggctcggcggccggaaac
gctggcttcggagccttaggcgccgcggcctttccttgttttccgcccagtccacgccgc
catggccaagtggggccaggggaacccccactggatcgtggaggagcgggaggacgggac
caacgtgaacaactggcgctggcgcggctggcggcggcctccttccgggatctggggagg
gccgggccgcgggagccggggctgccctggggtctgtgcggggccgcggggccagggggt
cagggggccgccccccctcagctgctggacgcagggctcggccttcgcctctcggctcgg
gagagtccttgagtacggagaccggctaggagggttgcagctgcctctttttgaaagttg
ggttgggccccaagagtgacttccgacagacctttccactcccaccgtctgtggcctgag
ggccttcccttctcctcccgcccacccctctggatgtttcggggagttagaagggagctg
gattgagagactgtgttaggggcgggggtatggaacgtagtggaaagggcagaaatttgg
atctcagttcgcgcccaccccgcaggcgcctcccgcgagccgggccctctgtgagtgaga
caagctccccttcctttacgcgcctcacctggcgcgtggggagaggtcggcagccctccg
ccgcagaacctccggaagggatgtcctctgccctgcgcctctggccggggctgtggtccc
tccaggccgtcgaggggatgctgaggccggtccccagaggagcatgacttggctggtccg
gaggagctctgagggcatgggcaatcttggctcgctgcaacctcagcttccagagttcaa
gcgagtctcctgcttcagcctcatgagtagctgggactacagatgcgtgccactacgtcc
gtctgatgtttgtatttttagtagagacagggtttcaccatgttggtcaggctgctctcg
aactccagatctcgtgatccgcccgcctgggcctactaaagtgctgggattacaggcgtg
agctagatctgactttctagtgtcctagccttggcccgatggacatgtcatttctctcag
ctcgtttctgtcccctaaagtgagaatattgcctgggaagattacattagacgatgtata
tgcgaagacacttgatagctggtattgtcatgattctgattagttcactactgctacttt
ccctgtggcctaggctttgcctatttccagtgggcgagctagctagatcctcctccctta
aataagccagtgtttttaagacagaatactacttgcatagtggacaataatatcttaaag
aactgagcaggatgaaaagaatttgatagaaagcaggtttgaggagcacattggaggttg
gcaggtttcgaggctgcttgagaggacttgggccgatctgggctgggcttggacgtgacc
ctggcacccaggcaggtggatcccagctggggcttccattcacgactttctggtccctgg
caggacagagcgggatgccaccagcttgtccaaagggaagttccaggagctcctggtggg
catcgttgtggagaatgacgctggccgcggcgagatcaacgagttgaagcaggtggaagg
ggaggcttcgtgcagcagccgcaaaggaaagctgattttcttctatgagtggaacatcaa
actgggctggaaaggcatcgttaaagaatctggagtgaagcacaagggattgattgaaat
acccaatctttctgaggaaaatgaagtagatgacactgaggtcaacgttgagtaaaaaga
aaggagatggggttatactgaaggatcttatgaaaactgcaggcactgccaaggtcaggg
aggcccttggagattacctgaaggcacttaagacggaatttacaacgggaatgattttac
caacgaaagctatggcaacccaggaattgactgtcaaaagaaaactgagtgggaataccc
tgcaggttcaggcctcatctccagtggcactgggtgtaaggattcccactgtggctcttc
acatgatggaactgtttgacacaactgtagagcagctgtatagcatcttcactgtaaagg
agttaacaaataagaagatcatcatgaaatggagatgtgggaactggccagaagaacact
atgccatggttgcactgaattttgtgcctactctagggcaaacagaattacaattgaagg
agttcctatctatctgtaaagaagagaacatgaaattctgttggcagaagcagcattttg
aagaaataaaaggttcactgcagctgacccccctaaatggttgaattaaaatttattata
aggcattactttttgtaagcggaaaaagtgtcacatttacctcttccctatcttttgttt
aaaaggactgtctttattttatattggatgaaatctatgaacatatatacaatgtaaagc
attgtttgactctttattataactagacactgcattgatttaaaagtagcaaacaacctg
aaattaagtattaacctgaccttccatcgatattcctctggaaataggtaagtcctgagt
gcagatagttgatgtttcccaagctgaagcttgtcctatagcaagcttgcttgcagctgt
acttttagttcaagatgacaaaaaataaatggcatgttgacactattcctttattttact
ttagggtttttaaggtgtgtagatcttaggtcgtaaaacagtggtatattgcattcaaaa
gcatgttgaggtgagggcaaattggctgtgttttgctccacatctccctgcacatctccc
tgctgtggttttgcacttcggtgtggagaggattgagaagtctgtggggacacattagtt
ctgtggactgctggtaacacttccagtgaaacagcatataatggataaatgtttcccccc
tctttcacggttttctcactactttcacctgagaagactgaagcaacgtatgtaaacaaa
tgaaaagtcatcacaatcagtttaattaagtgcacagaatagcaatcaatcaatcagtca
tgtcaataaaaataaaacaattatttttaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

DBGET integrated database retrieval system