KEGG   Homo sapiens (human): 254958Help
Entry
254958            misc_RNA  T01001                                 

Gene name
REXO1L1P, GOR, REXO1L1
Definition
(RefSeq) REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 1, pseudogene
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
HGNC: 
HPRD: 
Ensembl: 
Position
8q21.2
NT seq 2028 nt NT seq  +upstreamnt  +downstreamnt
atgttgcgagccacagctccctgctggttcccccctggatacccagaagctaagaaggtg
gccgaggaggcggccctggaggcaagccgccatttgggaggggagcagagccaggccggt
gctcccgaaggcagcaagatgttgcgagccacagctccctgctggttccgccctggatac
ccagaagctaagaaggtggccaaggaggcggccccggaggcaagccgccatttggcagcg
gagcagagcccggccggtgctcccgaaggcagcaagatgttgcgagccacagctccctgc
tggttcccacctggatacccagaagctaagaaggtggccgaggaggcggccctcgaggct
ccagaattcccactgccctctcatcagcctgcccagagcttcgggctctgggtgccccag
atgcacaagcaggcctcagcatttgtggacatccaggcggagccccagaacaggggtccg
gcggtgcccccagcgtggcccaagatggtgacggagtcgtgctacttccctgcgcagagg
ggatcggcctgccgcttgccagccgccccaaggctgacagagaggccctcgggagtccgc
atctcagcccccaggaagaggaagacgatcgcccactcttccagcccttgcttggtcaca
ggttacacagatgccaagagaacccgggtggccagcagcagccaacgctcccgtggctcc
aaggtcggcagacagccagggaagacgcgcaacaggtcagggatggcatgcaagaccacc
gccaccaccagctctaagcgaatcgtccgtcgtgcatccttaccgagtttgagtttgaag
aaacccattatcctccgaagctctgggtgccaagtccccaccgtcctccgccgaggctat
ctccaactgttcaccgaagagtgtctcaagttctgcgcctccaagcaggaggccgaggag
aaggcgctgaacgaggagaaggtggcctacgactgcagccccaacaagaacaggtacctg
aacgtggtcctgaacaccctcaagagactgaagggcctgacccccagctccatgcccggc
ctcagcagggccgccctgtacagccgcctccaggagttcctgctcacccaggaccagctc
aaggagaacggctaccccttcccgcaccccgagcggcccggaggcgccgtcctcttcact
ggccaggggaaggggcccggcgactcctcctgcagggtctgctgccgttgtggcaccgag
tacctggtgtcctcctcgggccgctgtgtacgcgaccagttgtgttattatcactggggg
cgggtccgctcgagccaggtggctggaggccgggttagccagtacacctgctgtgcagct
gctcctggctctgtgggctgccaggtggcaaagcagcacgtgcgggacggccgcaaggag
agcctcgatggcttcgtggagaccttcaagaaagagttgtccagagacgcttatccagga
atctacgccttggactgtgagatgtgctacaccacgcatggcctagagctgacccgcgtc
accgtggtggacgccgacatgcgagtggtgtacgacaccttcgtcaagcccgacaacgag
atcgtggactacaacaccaggttttccggagtcaccgaggccgacgtcgccaagacgagc
atcacgttgccccaagtccaagccatcctgctgagctttttcagcgcccaaaccatcctc
atcgggcacagcctggagagcgacctgctggccctgaagctcatccacagcaccgtggtg
gacacggccgtgctcttcccgcactacctgggtttcccctacaagcgctccctcaggaat
ctcgcggccgactacctggcacagatcatccaggacagccaggacggccacaactccagc
gaggacgcaagcgcctgcctgcagctggtgatgtggaaggtccgacagcgcgcccagatc
cagccacgccaccggtccgcctctcccgccgccctggcctgtccttag

DBGET integrated database retrieval system