KEGG   Homo sapiens (human): 283120Help
Entry
283120            lncRNA    T01001                                 

Gene name
H19, ASM, ASM1, BWS, D11S813E, LINC00008, NCRNA00008, WT2
Definition
(RefSeq) H19, imprinted maternally expressed transcript (non-protein coding)
Organism
hsa  Homo sapiens (human)
Disease
H00711  
Russell-Silver syndrome
H00713  
Beckwith-Wiedemann syndrome
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Ensembl: 
Position
11p15.5
NT seq 2362 nt NT seq  +upstreamnt  +downstreamnt
agttagaaaaagcccgggctaggaccgaggagcagggtgagggagggggtgggatgggtg
gggggtaacgggggaaactggggaagtggggaaccgaggggcaaccaggggaagatgggg
tgctggaggagagcttgtgggagccaaggagcaccttggacatctggagtctggcaggag
tgatgacgggtggaggggctagctcgaggcagggctggtggggcctgaggccagtgagga
gtgtggagtaggcgcccaggcatcgtgcagacagggcgacatcagctggggacgatgggc
ctgagctagggctggaaagaagggggagccaggcattcatcccggtcacttttggttaca
ggacgtggcagctggttggacgaggggagctggtgggcagggtttgatcccagggcctgg
gcaacggaggtgtagctggcagcagcgggcaggtgaggaccccatctgccgggcaggtga
gtcccttccctccccaggcctcgcttccccagccttctgaaagaaggaggtttaggggat
cgagggctggcggggagaagcagacaccctcccagcagaggggcaggatgggggcaggag
agttagcaaaggtgacatcttctcggggggagccgagactgcgcaaggctggggggttat
gggcccgttccaggcagaaagagcaagagggcagggagggagcacaggggtggccagcgt
agggtccagcacgtggggtggtaccccaggcctgggtcagacagggacatggcaggggac
acaggacagaggggtccccagctgccacctcacccaccgcaattcatttagtagcaggca
caggggcagctccggcacggctttctcaggcctatgccggagcctcgagggctggagagc
gggaagacaggcagtgctcggggagttgcagcaggacgtcaccaggagggcgaagcggcc
acgggaggggggccccgggacattgcgcagcaaggaggctgcaggggctcggcctgcggg
cgccggtcccacgaggcactgcggcccagggtctggtgcggagagggcccacagtggact
tggtgacgctgtatgccctcaccgctcagcccctggggctggcttggcagacagtacagc
atccaggggagtcaagggcatggggcgagaccagactaggcgaggcgggcggggcggagt
gaatgagctctcaggagggaggatggtgcaggcaggggtgaggagcgcagcgggcggcga
gcgggaggcactggcctccagagcccgtggccaaggcgggcctcgcgggcggcgacggag
ccgggatcggtgcctcagcgttcgggctggagacgaggccaggtctccagctggggtgga
cgtgcccaccagctgccgaaggccaagacgccaggtccggtggacgtgacaagcaggaca
tgacatggtccggtgtgacggcgaggacagaggaggcgcgtccggccttcctgaacacct
taggctggtggggctgcggcaagaagcgggtctgtttctttacttcctccacggagtcgg
cacactatggctgccctctgggctcccagaacccacaacatgaaagaaatggtgctaccc
agctcaagcctgggcctttgaatccggacacaaaaccctctagcttggaaatgaatatgc
tgcactttacaaccactgcactacctgactcaggaatcggctctggaaggtgaagctaga
ggaaccagacctcatcagcccaacatcaaagacaccatcggaacagcagcgcccgcagca
cccaccccgcaccggcgactccatcttcatggccaccccctgcggcggacggttgaccac
cagccaccacatcatcccagagctgagctcctccagcgggatgacgccgtccccaccacc
tccctcttcttctttttcatccttctgtctctttgtttctgagctttcctgtctttcctt
ttttctgagagattcaaagcctccacgactctgtttcccccgtcccttctgaatttaatt
tgcactaagtcatttgcactggttggagttgtggagacggccttgagtctcagtacgagt
gtgcgtgagtgtgagccaccttggcaagtgcctgtgcagggcccggccgccctccatctg
ggccgggtgactgggcgccggctgtgtgcccgaggcctcaccctgccctcgcctagtctg
gaagctccgaccgacatcacggagcagccttcaagcattccattacgccccatctcgctc
tgtgcccctccccaccagggcttcagcaggagccctggactcatcatcaataaacactgt
tacagcaaaaaaaaaaaaaaaa

DBGET integrated database retrieval system