KEGG   Homo sapiens (human): 29947Help
Entry
29947             CDS       T01001                                 

Gene name
DNMT3L
Definition
DNA (cytosine-5-)-methyltransferase 3-like
Orthology
K17400  
DNA (cytosine-5)-methyltransferase 3-like
Organism
hsa  Homo sapiens (human)
Drug target
Azacitidine: 
Decitabine: 
SSDB OrthologParalogGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
OMIM: 
HGNC: 
HPRD: 
Ensembl: 
Vega: 
UniProt: 
Structure
PDB: 

Jmol
Position
21q22.3
AA seq 387 aa AA seqDB search
MAAIPALDPEAEPSMDVILVGSSELSSSVSPGTGRDLIAYEVKANQRNIEDICICCGSLQ
VHTQHPLFEGGICAPCKDKFLDALFLYDDDGYQSYCSICCSGETLLICGNPDCTRCYCFE
CVDSLVGPGTSGKVHAMSNWVCYLCLPSSRSGLLQRRRKWRSQLKAFYDRESENPLEMFE
TVPVWRRQPVRVLSLFEDIKKELTSLGFLESGSDPGQLKHVVDVTDTVRKDVEEWGPFDL
VYGATPPLGHTCDRPPSWYLFQFHRLLQYARPKPGSPRPFFWMFVDNLVLNKEDLDVASR
FLEMEPVTIPDVHGGSLQNAVRVWSNIPAIRSSRHWALVSEEELSLLAQNKQSSKLAAKW
PTKLVKNCFLPLREYFKYFSTELTSSL
NT seq 1164 nt NT seq  +upstreamnt  +downstreamnt
atggcggccatcccagccctggacccagaggccgagcccagcatggacgtgattttggtg
ggatccagtgagctctcaagctccgtttcacccgggacaggcagagatcttattgcatat
gaagtcaaggctaaccagcgaaatatagaagacatctgcatctgctgcggaagtctccag
gttcacacacagcaccctctgtttgagggagggatctgcgccccatgtaaggacaagttc
ctggatgccctcttcctgtacgacgatgacgggtaccaatcctactgctccatctgctgc
tccggagagacgctgctcatctgcggaaaccctgattgcacccgatgctactgcttcgag
tgtgtggatagcctggtcggccccgggacctcggggaaggtgcacgccatgagcaactgg
gtgtgctacctgtgcctgccgtcctcccgaagcgggctgctgcagcgtcggaggaagtgg
cgcagccagctcaaggccttctacgaccgagagtcggagaatccccttgagatgttcgaa
accgtgcctgtgtggaggagacagccagtccgggtgctgtccctttttgaagacatcaag
aaagagctgacgagtttgggctttttggaaagtggttctgacccgggacaactgaagcat
gtggttgatgtcacagacacagtgaggaaggatgtggaggagtggggacccttcgatctt
gtgtacggcgccacacctcccctgggccacacctgtgaccgtcctcccagctggtacctg
ttccagttccaccggctcctgcagtacgcacggcccaagccaggcagccccaggcccttc
ttctggatgttcgtggacaatctggtgctgaacaaggaagacctggacgtcgcatctcgc
ttcctggagatggagccagtcaccatcccagatgtccacggcggatccttgcagaatgct
gtccgcgtgtggagcaacatcccagccataaggagcagcaggcactgggctctggtttcg
gaagaagaattgtccctgctggcccagaacaagcagagctcgaagctcgcggccaagtgg
cccaccaagctggtgaagaactgctttctccccctaagagaatatttcaagtatttttca
acagaactcacttcctctttataa

DBGET integrated database retrieval system