KEGG   Homo sapiens (human): 326343Help
Entry
326343            misc_RNA  T01001                                 

Gene name
MT1DP, MTM
Definition
metallothionein 1D, pseudogene
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
HGNC: 
HPRD: 
Position
16q13
NT seq 376 nt NT seq  +upstreamnt  +downstreamnt
cctgtggcttaggaactccagcctcacctgatctccgaatggacctcagctgctcctgcg
ccactggtggctcctgcacctgtgccagctcctgcaaatgcaaagagtacaaatgcacct
cctgcaagaagaactgctgctcctgctgccccatgggctgtgccaaatgtgcccagggct
gcacctgaaaaggggcattggagaagtgcagctgccgtgcctgatgttgggacagccctg
cgtccagttgtaaataacgcaacccctacaaatctagtttttttttaaacacaaacctaa
cccatttactatgtctgttttcttaaatgaaatatgggaatgataataaacattgttggc
cttaaaaaaaaaaaaa

DBGET integrated database retrieval system