KEGG   Homo sapiens (human): 3346Help
Entry
3346              CDS       T01001                                 

Gene name
HTN1, HIS1
Definition
histatin 1
Orthology
K13913  
histatin
Organism
hsa  Homo sapiens (human)
Pathway
Salivary secretion
Class
Organismal Systems; Digestive system; Salivary secretion [PATH:hsa04970]
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
OMIM: 
HGNC: 
HPRD: 
Ensembl: 
Vega: 
UniProt: 
Position
4q13
AA seq 57 aa AA seqDB search
MKFFVFALVLALMISMISADSHEKRHHGYRRKFHEKHHSHREFPFYGDYGSNYLYDN
NT seq 174 nt NT seq  +upstreamnt  +downstreamnt
atgaagttttttgtctttgctttagtcttggctctcatgatttccatgattagcgctgat
tcacatgaaaagagacatcatgggtatagaagaaaattccatgaaaagcatcattcacat
cgagaatttccattttatggggactatggatcaaattatctatatgacaattga

DBGET integrated database retrieval system