KEGG   Homo sapiens (human): 368Help
Entry
368               CDS       T01001                                 

Gene name
ABCC6, ABC34, ARA, EST349056, GACI2, MLP1, MOAT-E, MOATE, MRP6, PXE, PXE1, URG7
Definition
ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Orthology
K05669  
ATP-binding cassette, subfamily C (CFTR/MRP), member 6
Organism
hsa  Homo sapiens (human)
Pathway
ABC transporters
Disease
H00560  
Pseudoxanthoma elasticum
Class
Environmental Information Processing; Membrane transport; ABC transporters [PATH:hsa02010]
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
OMIM: 
HGNC: 
HPRD: 
Ensembl: 
Vega: 
UniProt: 
Position
16p13.1
AA seq 99 aa AA seqDB search
MAAPAEPCAGQGVWNQTEPEPAATSLLSLCFLRTAGVWVPPMYLWVLGPIYLLFIHHHGR
GYLRMSPLFKAKMVAAIPGSLEPGNVRGRQGTGWNLVKS
NT seq 300 nt NT seq  +upstreamnt  +downstreamnt
atggccgcgcctgctgagccctgcgcggggcagggggtctggaaccagacagagcctgaa
cctgccgccaccagcctgctgagcctgtgcttcctgagaacagcaggggtctgggtaccc
cccatgtacctctgggtccttggtcccatctacctcctcttcatccaccaccatggccgg
ggctacctccggatgtccccactcttcaaagccaagatggtagctgccatccctgggagc
ctggaaccaggcaatgttcgggggaggcaggggacaggctggaacctggtgaagtcttaa

DBGET integrated database retrieval system